Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU130111

Sigma-Aldrich

MISSION® esiRNA

targeting human CTCF

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AACAGCAGGAGGGTCTGCTATCAGAGGTTAATGCAGAGAAAGTGGTTGGTAATATGAAGCCTCCAAAGCCAACAAAAATTAAAAAGAAAGGTGTAAAGAAGACATTCCAGTGTGAGCTTTGCAGTTACACGTGTCCACGGCGTTCAAATTTGGATCGTCACATGAAAAGCCACACTGATGAGAGACCACACAAGTGCCATCTCTGTGGCAGGGCATTCAGAACAGTCACCCTCCTGAGGAATCACCTTAACACACACACAGGTACTCGTCCTCACAAGTGCCCAGACTGCGACATGGCCTTTGTGACCAGTGGAGAATTGGTTCGGCATCGTCGTTACAAACACACCCACGAGAAGCCATTCAAGTGTTCCATGTGCGATTACGCCAGTGTAGAAGTCAGCAAATTAAAACGTCACATTCGCTCTCATACTGGAGAGCGTCCGTTTCAGTGCAGTTTGTGCAGTTATGCCAGCAGGGACACATACAAGCTGAAAAGGCACATGA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zhengfei Shan et al.
Journal of cellular and molecular medicine, 23(5), 3130-3139 (2019-03-16)
The present research focuses on the influence of CCCTC-binding factor (CTCF) on prostate cancer (PC) via the regulation of the FoxO signalling pathway. A bioinformatics analysis was conducted to screen out target genes for CTCF in LNCaP cells and to
Nathan A Damaschke et al.
Clinical epigenetics, 12(1), 80-80 (2020-06-07)
The chromatin insulator CCCTC-binding factor (CTCF) displays tissue-specific DNA binding sites that regulate transcription and chromatin organization. Despite evidence linking CTCF to the protection of epigenetic states through barrier insulation, the impact of CTCF loss on genome-wide DNA methylation sites
Han Zhou et al.
JCI insight, 5(3) (2020-02-14)
Vascular inflammation is present in many cardiovascular diseases, and exogenous glucocorticoids have traditionally been used as a therapy to suppress inflammation. However, recent data have shown that endogenous glucocorticoids, acting through the endothelial glucocorticoid receptor, act as negative regulators of
Francisco Puerta Martínez et al.
Journal of virology, 88(13), 7389-7401 (2014-04-18)
Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA
Tommy W Terooatea et al.
Nucleic acids research, 44(21), e159-e159 (2016-08-24)
Recently, a number of advances have been implemented into the core ChIP-seq (chromatin immunoprecipitation coupled with next-generation sequencing) methodology to streamline the process, reduce costs or improve data resolution. Several of these emerging ChIP-based methods perform additional chemical steps on

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico