Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EMU184491

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gapdh

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCAAGAAGGTGGTGAAGCAGGCATCTGAGGGCCCACTGAAGGGCATCTTGGGCTACACTGAGGACCAGGTTGTCTCCTGCGACTTCAACAGCAACTCCCACTCTTCCACCTTCGATGCCGGGGCTGGCATTGCTCTCAATGACAACTTTGTCAAGCTCATTTCCTGGTATGACAATGAATACGGCTACAGCAACAGGGTGGTGGACCTCATGGCCTACATGGCCTCCAAGGAGTAAGAAACCCTGGACCACCCACCCCAGCAAGGACACTGAGCAAGAGAGGCCCTATCCCAACTCGGCCCCCAACACTGAGCATCTCCCTCACAATTTCCATCCCAGACCCCCATAATAACAGGAGGGGCCTAGGGAGCCCTCCCTACTCTCTTGAATACCATCAATAAAGTTCGCTGC

N° accesso Ensembl | topo

ENSMUSG00000057666

N° accesso NCBI

NM_008084

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... GAPDH(100042025) , Gapdh(14433)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Feifei Feng et al.
Environmental health perspectives, 120(12), 1692-1698 (2012-09-27)
The role of the Nlrp3 inflammasome in nonallergic airway hyperresponsiveness (AHR) has not previously been reported. Recent evidence supports both interleukin (IL) 1β and short fragments of hyaluronan (HA) as contributors to the biological response to inhaled ozone. Because extracellular
Shlomit Farkash-Amar et al.
PLoS genetics, 10(3), e1004176-e1004176 (2014-03-08)
To understand gene function, genetic analysis uses large perturbations such as gene deletion, knockdown or over-expression. Large perturbations have drawbacks: they move the cell far from its normal working point, and can thus be masked by off-target effects or compensation
Laurence Booth et al.
Molecular cancer therapeutics, 13(10), 2384-2398 (2014-08-12)
The present studies examined the toxic interaction between the non-coxib celecoxib derivative OSU-03012 and phosphodiesterase 5 (PDE5) inhibitors, and also determined the roles of endoplasmic reticulum stress response regulators in cell survival. PDE5 inhibitors interacted in a greater than additive
Danielle Bartlett et al.
PloS one, 10(4), e0124154-e0124154 (2015-04-17)
Melanoma is a highly aggressive and drug resistant form of skin cancer. It arises from melanocytes, the pigment producing cells of the skin. The formation of these melanocytes is driven by the transcription factor PAX3 early during embryonic development. As
Jane L Roberts et al.
Cancer biology & therapy, 15(6), 758-767 (2014-03-22)
We determined whether clinically relevant phosphodiesterase 5 (PDE5) inhibitors interacted with clinically relevant chemotherapies to kill medulloblastoma cells. In medulloblastoma cells PDE5 inhibitors interacted in a greater than additive fashion with vincristine/etoposide/cisplatin to cause cell death. Knockdown of PDE5 expression
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.