Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU084091

Sigma-Aldrich

MISSION® esiRNA

targeting human ARRB1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GAGCACGCTTACCCTTTCACCTTTGAGATCCCTCCAAACCTTCCATGTTCTGTGACACTGCAGCCGGGGCCCGAAGACACGGGGAAGGCTTGCGGTGTGGACTATGAAGTCAAAGCCTTCTGCGCGGAGAATTTGGAGGAGAAGATCCACAAGCGGAATTCTGTGCGTCTGGTCATCCGGAAGGTTCAGTATGCCCCAGAGAGGCCTGGCCCCCAGCCCACAGCCGAGACCACCAGGCAGTTCCTCATGTCGGACAAGCCCTTGCACCTAGAAGCCTCTCTGGATAAGGAGATCTATTACCATGGAGAACCCATCAGCGTCAACGTCCACGTCACCAACAACACCAACAAGACGGTGAAGAAGATCAAGATCTCAGTGCGCCAGTATGCAGACATCTGCCTTTTCAACACAGCTCAGTACAAGTGCCCTGTTGCC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Rui Yamaguchi et al.
The American journal of the medical sciences, 357(6), 492-506 (2019-03-27)
Plasminogen activator inhibitor type 1 promotes formation of endothelial microparticles with procoagulant activity. However, it remains unclear whether di-(2-ethylhexyl) phthalate, a peroxisome proliferator-activated receptor α agonist, influences microparticle formation. The effect of di-(2-ethylhexyl) phthalate on release of tissue factor-bearing microparticles
Vincent Zecchini et al.
The EMBO journal, 33(12), 1365-1382 (2014-05-20)
Tumour cells sustain their high proliferation rate through metabolic reprogramming, whereby cellular metabolism shifts from oxidative phosphorylation to aerobic glycolysis, even under normal oxygen levels. Hypoxia-inducible factor 1A (HIF1A) is a major regulator of this process, but its activation under
Susanne Neumann et al.
The Journal of pharmacology and experimental therapeutics, 364(1), 38-45 (2017-11-02)
Recently, we showed that TSH-enhanced differentiation of a human preosteoblast-like cell model involved a β-arrestin 1 (β-Arr 1)-mediated pathway. To study this pathway in more detail, we sought to discover a small molecule ligand that was functionally selective toward human

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.