Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU071121

Sigma-Aldrich

MISSION® esiRNA

targeting human NLRP3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACCTGGAGGATGTGGACTTGAAGAAATTTAAGATGCACTTAGAGGACTATCCTCCCCAGAAGGGCTGCATCCCCCTCCCGAGGGGTCAGACAGAGAAGGCAGACCATGTGGATCTAGCCACGCTAATGATCGACTTCAATGGGGAGGAGAAGGCGTGGGCCATGGCCGTGTGGATCTTCGCTGCGATCAACAGGAGAGACCTTTATGAGAAAGCAAAAAGAGATGAGCCGAAGTGGGGTTCAGATAATGCACGTGTTTCGAATCCCACTGTGATATGCCAGGAAGACAGCATTGAAGAGGAGTGGATGGGTTTACTGGAGTACCTTTCGAGAATCTCTATTTGTAAAATGAAGAAAGATTACCGTAAGAAGTACAGAAAGTACGTGAGAAGCAGATTCCAGTGCATTGAA

N° accesso Ensembl | uomo

ENSG00000162711

N° accesso NCBI

NM_183395

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... NLRP3(114548) , NLRP3(114548)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Maureen C Ty et al.
EMBO molecular medicine, 11(8), e9903-e9903 (2019-07-03)
Malaria is a highly inflammatory disease caused by Plasmodium infection of host erythrocytes. However, the parasite does not induce inflammatory cytokine responses in macrophages in vitro and the source of inflammation in patients remains unclear. Here, we identify oxidative stress, which
S F Khaiboullina et al.
Scientific reports, 7(1), 16050-16050 (2017-11-24)
ZIKV causes microcephaly by crossing the placental barrier, however, the mechanism of trans-placental dissemination of ZIKV remains unknown. Here, we sought to determine whether monocytes, which can cross tissue barriers, assist ZIKV dissemination to the fetus. We determined this by infecting monocytes
Qin Hu et al.
BioFactors (Oxford, England), 44(2), 123-136 (2017-12-02)
Increasing evidence demonstrates that pyroptosis, pro-inflammatory programmed cell death, is linked to atherosclerosis; however, the underlying mechanisms remain to be elucidated. Dihydromyricetin (DHM), a natural flavonoid, was reported to exert anti-oxidative and anti-inflammatory bioactivities. However, the effect of DHM on
Zhe Lin et al.
Biochimica et biophysica acta. Molecular basis of disease, 1864(9 Pt B), 2890-2900 (2018-06-03)
Oxidative stress and inflammation are closely related to cardiovascular diseases. Although hydrogen sulfide (H2S) has been shown to have powerful anti-oxidative and anti-inflammatory properties, its role in macrophage inflammation was poorly understood. The aim of this study was to investigate
Hui Fu et al.
Frontiers in pharmacology, 9, 968-968 (2018-09-07)
Backgrounds and Aims: Na+ is an important nutrient and its intake, mainly from salt (NaCl), is essential for normal physiological function. However, high salt intake may lead to vascular injury, independent of a rise in blood pressure (BP). Canonical NALP3
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.