Direkt zum Inhalt
Merck

EHU223451

Sigma-Aldrich

MISSION® esiRNA

targeting human POU5F1 (2)

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GACACCTGGCTTCGGATTTCGCCTTCTCGCCCCCTCCAGGTGGTGGAGGTGATGGGCCAGGGGGGCCGGAGCCGGGCTGGGTTGATCCTCGGACCTGGCTAAGCTTCCAAGGCCCTCCTGGAGGGCCAGGAATCGGGCCGGGGGTTGGGCCAGGCTCTGAGGTGTGGGGGATTCCCCCATGCCCCCCGCCGTATGAGTTCTGTGGGGGGATGGCGTACTGTGGGCCCCAGGTTGGAGTGGGGCTAGTGCCCCAAGGCGGCTTGGAGACCTCTCAGCCTGAGGGCGAAGCAGGAG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Axel R Göhring et al.
PloS one, 12(4), e0174912-e0174912 (2017-04-21)
Oct4 was reported to be one of the most important pluripotency transcription factors in the biology of stem cells including cancer stem cells, and progressed malignant cells. Here we report the investigation of gene expression control of Oct4 by selected
Shaoheng Zhang et al.
Cell death & disease, 8(1), e2548-e2548 (2017-01-13)
Poor cell survival and limited functional benefits have restricted mesenchymal stem cell (MSC) efficacy for treating myocardial infarction (MI), suggesting that a better understanding of stem cell biology is needed. The transcription factor HIF-2α is an essential regulator of the
Pengmu Xie et al.
Experimental and molecular pathology, 108, 9-16 (2019-03-12)
Endometrial cancer (EC) is ranked as the most common gynecologic malignancy of the female genital tract and the fourth most common neoplasia in women. Accumulated evidences reveal that TRAF4 plays a critical role in the progress of various cancers, but
Lei Liu et al.
Biochemical and biophysical research communications, 461(3), 525-532 (2015-04-26)
Our previous study showed that Octamer-binding transcription factor 4 (OCT4) expression was upregulated and significantly associated with histological grade through the analysis of OCT4 expression in 159 ovarian cancer tissue samples, and OCT4 mediated follicle-stimulating hormone (FSH)-induced anti-apoptosis in epithelial
Sung-Jen Wei et al.
Cell death & disease, 11(5), 368-368 (2020-05-16)
Despite the improvement in clinical outcome with 13-cis-retinoic acid (13-cisRA) + anti-GD2 antibody + cytokine immunotherapy given in first response ~40% of high-risk neuroblastoma patients die of recurrent disease. MYCN genomic amplification is a biomarker of aggressive tumors in the

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.