Direkt zum Inhalt
Merck

EHU157921

Sigma-Aldrich

MISSION® esiRNA

targeting human TFE3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTGAGGCTGCCCACACTACCGGCCCCACAGGCAGTGCGCCCAACAGCCCCATGGCGCTGCTCACCATCGGGTCCAGCTCAGAGAAGGAGATTGATGATGTCATTGATGAGATCATCAGCCTGGAGTCCAGTTACAATGATGAAATGCTCAGCTATCTGCCCGGAGGCACCACAGGACTGCAGCTCCCCAGCACGCTGCCTGTGTCAGGGAATCTGCTTGATGTGTACAGTAGTCAAGGCGTGGCCACACCAGCCATCACTGTCAGCAACTCCTGCCCAGCTGAGCTGCCCAACATCAAACGGGAGATCTCTGAGACCGAGGCAAAGGCCCTTTTGAAGGAACGGCAGAAGAAAGACAATCACAACCTAATTGAGCGTCGCAGGCGATTCAACATTAACGACAGGATCAAGGAACTGGGCACTCTCATCCCTAAGTCCAGTGACCCGGAG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Nunzia Pastore et al.
The EMBO journal, 38(12) (2019-05-28)
Autophagy and energy metabolism are known to follow a circadian pattern. However, it is unclear whether autophagy and the circadian clock are coordinated by common control mechanisms. Here, we show that the oscillation of autophagy genes is dependent on the
Na Zhang et al.
EBioMedicine, 40, 151-162 (2019-02-04)
Programmed death-ligand 1 (PD-L1) is a T-cell inhibitory checkpoint molecule that suppresses antitumor immunity. Anti-PD-L1 antibodies have shown remarkable promise in treating tumors, but the patient response rate is low. Therefore, small-molecule checkpoint inhibitors blocking PD-L1 function are urgently needed.
Leeanna El-Houjeiri et al.
Cell reports, 26(13), 3613-3628 (2019-03-28)
TFEB and TFE3 are transcriptional regulators of the innate immune response, but the mechanisms regulating their activation upon pathogen infection are poorly elucidated. Using C. elegans and mammalian models, we report that the master metabolic modulator 5'-AMP-activated protein kinase (AMPK) and
Chuanbin Yang et al.
Redox biology, 32, 101445-101445 (2020-02-11)
TFEB (transcription factor EB) and TFE3 (transcription factor E3) are "master regulators" of autophagy and lysosomal biogenesis. The stress response p38 mitogen-activated protein (MAP) kinases affect multiple intracellular responses including inflammation, cell growth, differentiation, cell death, senescence, tumorigenesis, and autophagy.
Ikue Tai-Nagara et al.
Nature communications, 11(1), 6314-6314 (2020-12-11)
Blood and lymphatic vessels structurally bear a strong resemblance but never share a lumen, thus maintaining their distinct functions. Although lymphatic vessels initially arise from embryonic veins, the molecular mechanism that maintains separation of these two systems has not been

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.