Direkt zum Inhalt
Merck

EHU125271

Sigma-Aldrich

MISSION® esiRNA

targeting human PLAUR

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GACCCTGAGCTATCGGACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTGTGTGGGTTAGACTTGTGCAACCAGGGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTACCTCGAATGCATTTCCTGTGGCTCATCAGACATGAGCTGTGAGAGGGGCCGGCACCAGAGCCTGCAGTGCCGCAGCCCTGAAGAACAGTGCCTGGATG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

P S Klimovich et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 125, 110008-110008 (2020-03-20)
Urokinase receptor (uPAR) promotes extracellular matrix proteolysis, regulates adhesion and cell migration, transduces intracellular signals through interactions with the lateral partners. The expression of uPAR and urokinase (uPA) is significantly upregulated in peripheral nerves after injury, however, little is known
K D Rysenkova et al.
Cellular signalling, 75, 109741-109741 (2020-08-22)
Urokinase-type plasminogen activator uPA and its receptor (uPAR) are the central players in extracellular matrix proteolysis, which facilitates cancer invasion and metastasis. EGFR is one of the important components of uPAR interactome. uPAR/EGFR interaction controls signaling pathways that regulate cell
Xin Li et al.
Oncotarget, 8(51), 88645-88657 (2017-11-29)
Dissection and understanding of the molecular pathways driving triple-negative breast cancer (TNBC) are urgently needed to develop efficient tailored therapies. Aside from cell invasion and metastasis, the urokinase-type plasminogen activator receptor (uPAR) has been linked to apoptosis resistance in breast
Yohei Yamagami et al.
Biochemical and biophysical research communications, 525(3), 543-548 (2020-03-03)
There is increasing evidence that epithelial-mesenchymal transition (EMT) contributes to the development of organ fibrosis. We demonstrated that methotrexate (MTX) clearly induced EMT through the transforming growth factor (TGF)-β-related signaling pathway in human alveolar epithelial cell line, A549. However, critical
Xuexiang Gao et al.
Oncology letters, 16(3), 3983-3991 (2018-08-22)
Overexpression of urokinase-type plasminogen activator receptor (uPAR) has been implicated in promoting tumor invasion in various cancer types, including oral tongue squamous cell carcinoma (OTSCC); therefore, the effect of suppressing uPAR expression on the invasive and metastatic potential of OTSCC

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.