Direkt zum Inhalt
Merck

EHU115021

Sigma-Aldrich

MISSION® esiRNA

targeting human NF1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TATGGATCGGCTGTTGTCCTTAATGGTGTGTAACCATGAGAAAGTGGGACTTCAAATACGGACCAATGTTAAGGATCTGGTGGGTCTAGAATTGAGTCCTGCTCTGTATCCAATGCTATTTAACAAATTGAAGAATACCATCAGCAAGTTTTTTGACTCCCAAGGACAGGTTTTATTGACTGATACCAATACTCAATTTGTAGAACAAACCATAGCTATAATGAAGAACTTGCTAGATAATCATACTGAAGGCAGCTCTGAACATCTAGGGCAAGCTAGCATTGAAACAATGATGTTAAATCTGGTCAGGTATGTTCGTGTGCTTGGGAATATGGTCCATGCAATTCAAATAAAAACGAAACTGTGTCAATTAGTTGAAGTAATGATGGCAAGGAGAGATGACC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Dana Rabara et al.
Proceedings of the National Academy of Sciences of the United States of America, 116(44), 22122-22131 (2019-10-16)
KRAS mutations occur in ∼35% of colorectal cancers and promote tumor growth by constitutively activating the mitogen-activated protein kinase (MAPK) pathway. KRAS mutations at codons 12, 13, or 61 are thought to prevent GAP protein-stimulated GTP hydrolysis and render KRAS-mutated
K Mellert et al.
Scientific reports, 8(1), 6171-6171 (2018-04-20)
In Neurofibromatosis 1 (NF1) germ line loss of function mutations result in reduction of cellular neurofibromin content (NF1+/-, NF1 haploinsufficiency). The Ras-GAP neurofibromin is a very large cytoplasmic protein (2818 AA, 319 kDa) involved in the RAS-MAPK pathway. Aside from regulation
Lionel Larribère et al.
Translational oncology, 13(12), 100858-100858 (2020-09-07)
Metastases's spreading is the main cause of mortality for advanced stage cancer patients, including melanoma. The formation of metastases is favored by enhanced migratory and invasive capacities of tumor cells. Tumor suppressor gene NF1 is a negative regulator of RAS
Ritsuko Harigai et al.
Scientific reports, 8(1), 6069-6069 (2018-04-19)
Neurofibromatosis type 1 (NF1) is caused by germline mutations in the NF1 gene and is characterized by café au lait spots and benign tumours known as neurofibromas. NF1 encodes the tumour suppressor protein neurofibromin, which negatively regulates the small GTPase
Ze-Yi Zheng et al.
Cancer cell, 37(3), 387-402 (2020-03-07)
We report that neurofibromin, a tumor suppressor and Ras-GAP (GTPase-activating protein), is also an estrogen receptor-α (ER) transcriptional co-repressor through leucine/isoleucine-rich motifs that are functionally independent of GAP activity. GAP activity, in turn, does not affect ER binding. Consequently, neurofibromin

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.