Direkt zum Inhalt
Merck

EHU043571

Sigma-Aldrich

MISSION® esiRNA

targeting human YY1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GTCACCATGTGGTCCTCAGATGAAAAAAAAGATATTGACCATGAGACAGTGGTTGAAGAACAGATCATTGGAGAGAACTCACCTCCTGATTATTCAGAATATATGACAGGAAAGAAACTTCCTCCTGGAGGAATACCTGGCATTGACCTCTCAGATCCCAAACAACTGGCAGAATTTGCTAGAATGAAGCCAAGAAAAATTAAAGAAGATGATGCTCCAAGAACAATAGCTTGCCCTCATAAAGGCTGCACAAAGATGTTCAGGGATAACTCGGCCATGAGAAAACATCTGCACACCCACGGTCCCAGAGTCCACGTCTGTGCAGAATGTGGCAAAGCTTTTGTTGAGAGTTCAAAACTAAAACGACACCAACTGGTTCATACTGGAGAGAAGCCCTTTCAGTGCA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

J-B Tian et al.
European review for medical and pharmacological sciences, 23(13), 5714-5729 (2019-07-13)
Increasing studies have confirmed long non-coding RNAs (lncRNAs) as novel regulators in tumorigenesis. LncRNA DDX11 antisense RNA 1 (DDX11-AS1) has been found to be abnormally expressed in several tumors. In this work, we aimed to evaluate its expressions and functions
Jiyeon Choi et al.
Nature communications, 11(1), 2718-2718 (2020-06-03)
Genome-wide association studies (GWAS) have identified ~20 melanoma susceptibility loci, most of which are not functionally characterized. Here we report an approach integrating massively-parallel reporter assays (MPRA) with cell-type-specific epigenome and expression quantitative trait loci (eQTL) to identify susceptibility genes/variants
Huan Liu et al.
Scientific reports, 10(1), 20493-20493 (2020-11-26)
Angiogenesis is a physiological process for the formation of new blood vessels from the pre-existing vessels and it has a vital role in the survival and growth of neoplasms. During tumor angiogenesis, the activation of the gene transcriptions in vascular
Jinpiao Lin et al.
Journal of autoimmunity, 77, 67-75 (2016-11-11)
Previous studies have revealed a critical role of YY1, a "Yin Yang" transcription factor, in cancer development and progression. However, whether YY1 has any role in rheumatoid arthritis (RA) remains unknown. This study aims to explore the potential role of
Xin-Chun Zhang et al.
Biochemical and biophysical research communications, 502(2), 269-275 (2018-05-29)
Neuroinflammation plays a critical role in the process of neurodegenerative disorders, during which microglia, the principal resident immune cells in the central nervous system, are activated and produce proinflammatory mediators. Yin-Yang 1 (YY1), a multi-functional transcription factor, is widely expressed

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.