Direkt zum Inhalt
Merck

EHU035531

Sigma-Aldrich

MISSION® esiRNA

targeting human UPF1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGACGCCTACCAGTACCAGAACATATTCGGGCCCCTGGTCAAGCTGGAGGCCGACTACGACAAGAAGCTGAAGGAGTCCCAGACTCAAGATAACATCACTGTCAGGTGGGACCTGGGCCTTAACAAGAAGAGAATCGCCTACTTCACTTTGCCCAAGACTGACTCTGACATGCGGCTCATGCAGGGGGATGAGATATGCCTGCGGTACAAAGGGGACCTTGCGCCCCTGTGGAAAGGGATCGGCCACGTCATCAAGGTCCCTGATAATTATGGCGATGAGATCGCCATTGAGCTGCGGAGCAGCGTGGGTGCACCTGTGGAGGTGACTCACAACTTCCAGGTGGATTTTGTGTGGAAGTCGACCTCCTTTGACAGGATGCAGAGCGCATTGAAAACGTTTGCCGTGGATGAGACCTCGGTGTCTGGCTACATCTACCACAAGCTGTTGGGCCACGAGGTGGAGGACGTAAT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xiaojun Wang et al.
Environmental toxicology, 35(9), 998-1006 (2020-05-14)
The roles of long noncoding RNA (lncRNA) MACC1-AS1 have been revealed in various tumors. This work aims to explore the roles of lncRNA MACC1-AS1 in the stemness of nonsmall cell lung cancer (NSCLC) cells and the underlying mechanism. We showed
Aparna Kishor et al.
Nucleic acids research, 48(13), 7468-7482 (2020-06-17)
Alternative polyadenylation (APA) produces transcript 3' untranslated regions (3'UTRs) with distinct sequences, lengths, stabilities and functions. We show here that APA products include a class of cryptic nonsense-mediated mRNA decay (NMD) substrates with extended 3'UTRs that gene- or transcript-level analyses
Seo-Young Lee et al.
Oncogene, 38(10), 1597-1610 (2018-10-24)
The point mutation that substitutes lysine with arginine at position 120 of human p53 has been characterized as a missense mutation. The K120R mutation renders the p53 protein disabled for acetylation and, as a result, defective for apoptotic function, which
Nagakatsu Harada et al.
Journal of cellular biochemistry, 118(11), 3810-3824 (2017-04-07)
Nonsense-mediated mRNA decay (NMD) degrades mRNAs carrying a premature termination codon (PTC) in eukaryotes. Cellular stresses, including endoplasmic reticulum (ER) stress, inhibit NMD, and up-regulate PTC-containing mRNA (PTC-mRNA) levels in several cell lines. However, whether similar effects exist under in
Tereza Grymová et al.
Molecular immunology, 107, 91-96 (2019-01-28)
Mutations in the C1 inhibitor (C1INH) encoding gene, SERPING1, are associated with hereditary angioedema (HAE) which manifests as recurrent submucosal and subcutaneous edema episodes. The major C1INH function is the complement system inhibition, preventing its spontaneous activation. The presented study

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.