Direkt zum Inhalt
Merck

EHU030401

Sigma-Aldrich

MISSION® esiRNA

targeting human MELK

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Check Cart for Availability


Größe auswählen

Ansicht ändern
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

CHF 249.00


Check Cart for Availability

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCAAAACCCAAGGGTAACAAGGATTACCATCTACAGACATGCTGTGGGAGTCTGGCTTATGCAGCACCTGAGTTAATACAAGGCAAATCATATCTTGGATCAGAGGCAGATGTTTGGAGCATGGGCATACTGTTATATGTTCTTATGTGTGGATTTCTACCATTTGATGATGATAATGTAATGGCTTTATACAAGAAGATTATGAGAGGAAAATATGATGTTCCCAAGTGGCTCTCTCCCAGTAGCATTCTGCTTCTTCAACAAATGCTGCAGGTGGACCCAAAGAAACGGATTTCTATGAAAAATCTATTGAACCATCCCTGGATCATGCAAGATTACAACTATCCTGTTGAGTGGCAAAGCAAGAATCCTTTTATTCACCTCGATGATGATTGCGTAACAGAACTTTCTGTACATCACAGAAACAACAGGCAAACAATGGAGGATTTAATTTCACTGTGGCAGTATGATCACCTCACGG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Antonio Cigliano et al.
Medicina (Kaunas, Lithuania), 56(1) (2019-12-22)
Background and Objectives: Intrahepatic cholangiocarcinoma (iCCA) is a pernicious tumor characterized by a dismal outcome and scarce therapeutic options. To substantially improve the prognosis of iCCA patients, a better understanding of the molecular mechanisms responsible for development and progression of
Zhiwei Zhang et al.
Frontiers in oncology, 10, 453-453 (2020-05-12)
Uterine leiomyosarcoma (ULMS) is the most lethal gynecologic malignancy with few therapeutic options. Chemoresistance prevails as a major hurdle in treating this malignancy, yet the mechanism of chemoresistance remains largely unclear. In this study, we certified MELK as a poor
Gang Li et al.
Oncology letters, 15(6), 9934-9940 (2018-05-29)
Maternal embryonic leucine zipper kinase (MELK) is an important regulator in tumorigenesis of human breast cancer, and if silenced leads to programmed cell death in specific breast cancer cell lines, including MDA-MB-231 cells. In the present study, RNA interference, proliferation
Ke Wang et al.
Oncology reports, 39(6), 2777-2786 (2018-04-06)
Retinoblastoma (Rb) is the most frequent primary intraocular tumor usually diagnosed in infants and children, and current therapy for such disease is still limited. Corosolic acid (CA), an ursane-type pentacyclic triterpene, has been assessed as a promising anticancer agent with little impact

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.