Accéder au contenu
MilliporeSigma
Toutes les photos(2)

Principaux documents

EHU031251

Sigma-Aldrich

MISSION® esiRNA

targeting human CAV1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
303,00 $
50 μG
571,00 $

303,00 $


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
303,00 $
50 μG
571,00 $

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

303,00 $


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGCTGAGCGAGAAGCAAGTGTACGACGCGCACACCAAGGAGATCGACCTGGTCAACCGCGACCCTAAACACCTCAACGATGACGTGGTCAAGATTGACTTTGAAGATGTGATTGCAGAACCAGAAGGGACACACAGTTTTGACGGCATTTGGAAGGCCAGCTTCACCACCTTCACTGTGACGAAATACTGGTTTTACCGCTTGCTGTCTGCCCTCTTTGGCATCCCGATGGCACTCATCTGGGGCATTTACTTCGCCATTCTCTCTTTCCTGCACATCTGGGCAGTTGTACCATGCATTAAGAGCTTCCTGATTGAGATTCAGTGCATCAGCCGTGTCTATTCCATCTACGTCCACACCGTCTGTGACCCACTCTTTGAAGCTGTTGGGAAAATATTCAGCAATGTCCGCATC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sang Woong Park et al.
Pflugers Archiv : European journal of physiology, 469(5-6), 829-842 (2017-03-18)
Activation of L-type voltage-dependent Ca
Xing Wan et al.
Clinical and translational medicine, 9(1), 3-3 (2020-01-15)
The incidence and mortality rates of gastric cancer (GC) rank in top five among all malignant tumors. Chemokines and their receptor-signaling pathways reportedly play key roles in the metastasis of malignant tumor cells. Receptor activator of nuclear factor κB ligand
Natalia I Díaz-Valdivia et al.
Oncotarget, 8(67), 111943-111965 (2018-01-18)
Expression of the scaffolding protein Caveolin-1 (CAV1) enhances migration and invasion of metastatic cancer cells. Yet, CAV1 also functions as a tumor suppressor in early stages of cancer, where expression is suppressed by epigenetic mechanisms. Thus, we sought to identify
Morgan A Urello et al.
Acta biomaterialia, 62, 167-178 (2017-09-04)
Gene therapies have great potential in regenerative medicine; however, clinical translation has been inhibited by low stability and limited transfection efficiencies. Herein, we incorporate collagen-mimetic peptide (CMP)-linked polyplexes in collagen scaffolds to increase DNA stability by up to 400% and
Byung-Kyu Ryu et al.
BMC cancer, 17(1), 766-766 (2017-11-17)
Expression of caveolin-1 (Cav-1) is frequently altered in many human cancers and both tumor suppression and promotion functions of Cav-1 have been suggested based on its expression status. However, it remains unanswered how Cav-1 provokes opposite effects in different cancers

Articles

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique