Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU130711

Sigma-Aldrich

MISSION® esiRNA

targeting human FASN

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTGGTCTTGAACTCCTTGGCGGAAGAGAAGCTGCAGGCCAGCGTGAGGTGCTTGGCTACGCACGGTCGCTTCCTGGAAATTGGCAAATTCGACCTTTCTCAGAACCACCCGCTCGGCATGGCTATCTTCCTGAAGAACGTGACATTCCACGGGGTCCTACTGGATGCGTTCTTCAACGAGAGCAGTGCTGACTGGCGGGAGGTGTGGGCGCTTGTGCAGGCCGGCATCCGGGATGGGGTGGTACGGCCCCTCAAGTGCACGGTGTTCCATGGGGCCCAGGTGGAGGACGCCTTCCGCTACATGGCCCAAGGGAAGCACATTGGCAAAGTCGTCGTGCAGGTGCTTGCGGAGGAGCCGGAGGCAGTGCTGAAGGGGGCCAAACCCAAGCTGATGTCGGCCATCTCCAAGACCTTCTGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiaokun Gang et al.
The Prostate, 79(8), 864-871 (2019-04-08)
Fatty acid synthase (FASN) is vital for maintaining lipid homeostasis in prostate cancer (PCa) cells, which have an increased rate of de novo fatty acid (FA) synthesis. Mutations in the gene encoding the tumor suppressor speckle-type POZ protein (SPOP), which
Xing Zhong et al.
Oncology letters, 21(4), 245-245 (2021-03-06)
Diffuse large B-cell lymphoma (DLBCL) is the most common and heterogeneous lymphoid malignancy. The subtype with MYC and BCL-2 double-expressor lymphoma (DEL) was defined by its aggressive nature and poor survival outcome. Therefore, the development of effective therapies for the
Arif Khan et al.
International journal of nanomedicine, 15, 5575-5589 (2020-08-18)
The overexpression of Her-2 in 25-30% breast cancer cases and the crosstalk between Her-2 and fatty acid synthase (FASN) establishes Her-2 as a promising target for site-directed delivery. The present study aimed to develop the novel lipid base formulations to
James Drury et al.
Frontiers in oncology, 10, 1185-1185 (2020-08-28)
Fatty acid synthase, a key enzyme of de novo lipogenesis, is an attractive therapeutic target in cancer. The novel fatty acid synthase inhibitor, TVB-3664, shows anti-cancer activity in multiple cancers including colorectal cancer; however, it is unclear whether uptake of
Peng Gao et al.
Life sciences, 242, 117221-117221 (2019-12-28)
Endothelial cell (EC) tube formation is crucial for tumor angiogenesis, which becomes a target for chemotherapy. The anti-malaria agent dihydroartemisinin (DHA) inhibited tumor growth and angiogenesis. The aim of this study was to investigate the effects of DHA on EC

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique