Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU109591

Sigma-Aldrich

MISSION® esiRNA

targeting human PHB

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em30 de março de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em30 de março de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCTGAGCAACAGAAAAAGGCGGCCATCATCTCTGCTGAGGGCGACTCCAAGGCAGCTGAGCTGATTGCCAACTCACTGGCCACTGCAGGGGATGGCCTGATCGAGCTGCGCAAGCTGGAAGCTGCAGAGGACATCGCGTACCAGCTCTCACGCTCTCGGAACATCACCTACCTGCCAGCGGGGCAGTCCGTGCTCCTCCAGCTGCCCCAGTGAGGGCCCACCCTGCCTGCACCTCCGCGGGCTGACTGGGCCACAGCCCCGATGATTCTTAACACAGCCTTCCTTCTGCTCCCACCCCAGAAATCACTGTGAAATTTCATGATTGGCTTAAAGTGAAGGAAATAAAGGTAAAATCACTTCAGATCTCTAATTAGTCTATCAAATGAAACTCTTTCATTCTTCTCACATCCATCTACTTTTTTATCCACCTCCCTACCAAAAATTGCCAAGTGCCTATGCAAACCAGCT

Ensembl | Número de adesão de ser humano

ENSG00000167085

nº de adesão NCBI

NM_002634

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PHB(5245) , PHB(5245)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QEU
JRR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Lijun Sun et al.
Biochemical and biophysical research communications, 513(2), 446-451 (2019-04-11)
Influenza virus infection is associated with type 1 diabetes (T1DM), but its pathogenesis remains unclear. Here, our study found that one of the monoclonal antibodies against H1N1 influenza virus hemagglutinin(HA) cross-reacted with human pancreatic tissue and further demonstrated that it
Debabrata Chowdhury et al.
Molecular and cellular biochemistry, 425(1-2), 155-168 (2016-11-18)
Numerous hypertrophic stimuli, including β-adrenergic agonists such as isoproterenol (ISO), result in generation of reactive oxygen species (ROS) and alteration in the mitochondrial membrane potential (Δψ) leading to oxidative stress. This process is well associated with phosphorylation of thymoma viral
Hajime Yurugi et al.
Journal of cell science, 133(12) (2020-06-06)
The RAS oncogenes are frequently mutated in human cancers and among the three isoforms (KRAS, HRAS and NRAS), KRAS is the most frequently mutated oncogene. Here, we demonstrate that a subset of flavaglines, a class of natural anti-tumour drugs and
Kinnosuke Yahiro et al.
Cellular microbiology, 21(8), e13033-e13033 (2019-04-23)
Vibrio cholerae produced-Cholix toxin (Cholix) is a cytotoxin that ADP-ribosylates eukaryotic elongation factor 2, inhibiting protein synthesis, and inducing apoptosis. Here, we identified prohibitin (PHB) 1 and 2 as novel Cholix-interacting membrane proteins in immortalised human hepatocytes and HepG2 cells
Satomi Miwa et al.
Nature communications, 5, 3837-3837 (2014-05-13)
Mitochondrial function is an important determinant of the ageing process; however, the mitochondrial properties that enable longevity are not well understood. Here we show that optimal assembly of mitochondrial complex I predicts longevity in mice. Using an unbiased high-coverage high-confidence

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica