Pular para o conteúdo
Merck
Todas as fotos(2)

Documentos

EHU114431

Sigma-Aldrich

MISSION® esiRNA

targeting human KRAS

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(2)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAACAAATTAAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTGCCTTCTAGAACAGTAGACACAAAACAGGCTCAGGA

Ensembl | Número de adesão de ser humano

ENSG00000133703

nº de adesão NCBI

NM_033360

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... KRAS(3845) , KRAS(3845)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Qian Fan et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 44(4), 1311-1324 (2017-11-29)
MicroRNAs (miRNAs) have emerged as major regulators of tumour development and progression in non-small cell lung cancer (NSCLC). However, the role of miR-193a-3p in NSCLC is still unclear. Quantitative RT-PCR was used to detect miR-193a-3p expression levels in NSCLC tumour
Clinically Viable Gene Expression Assays with Potential for Predicting Benefit from MEK Inhibitors.
Roz Brant et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 23(6), 1471-1480 (2016-10-14)
Xinquan Liu et al.
International journal of nanomedicine, 14, 6589-6600 (2019-09-10)
The RAS family of oncogenes (KRAS, HRAS, NRAS) are the most frequent mutations in cancers and regulate key signaling pathways that drive tumor progression. As a result, drug delivery targeting RAS-driven tumors has been a long-standing challenge in cancer therapy.
Hong Yan et al.
American journal of cancer research, 9(2), 312-329 (2019-03-25)
Activated KRAS is frequently observed and paralleled by inactivating of tumor suppressors in lung cancer, while the mechanisms remained elusive. Here, our study revealed a microRNA was involved in KRAS overexpression, activation of KRAS signaling and its synergy with inactivating
Stella Liong et al.
Mediators of inflammation, 2018, 3645386-3645386 (2018-11-08)
Heightened placental inflammation and dysfunction are commonly associated in pregnant obese women compared to their pregnant lean counterparts. The small GTPase superfamily members known as the rat sarcoma viral oncogene homolog (Ras) proteins, in particular, the K-Ras and H-Ras isoforms
Exibir todos os documentos relacionados

Artigos

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica