Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU089831

Sigma-Aldrich

MISSION® esiRNA

targeting human MIA3 (1)

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GAGAGAGAACAGAATGTCAAGAATCAGGACTTGTTGCAGCAGGAAATCGAAGACTGGAGTAAATTACATGCTGAGCTCAGTGAGCAAATCAAATCATTTGAGAAGTCTCAGAAAGATTTGGAAGTAGCTCTTACTCACAAGGATGATAATATTAATGCTTTGACTAACTGCATTACACAGTTGAATCTGTTAGAGTGTGAATCTGAATCTGAGGGTCAAAATAAAGGTGGAAATGATTCAGATGAATTAGCAAATGGAGAAGTGGGAGGTGACCGGAATGAGAAGATGAAAAATCAAATTAAGCAGATGATGGATGTCTCTCGGACACAGACTGCAATATCGGTAGTTGAAGAGGATCTAAAGCTTTTACAGCTTAAGCTAAGAGCCTCCGTGTCCACTA

Ensembl | Número de adesão de ser humano

ENSG00000154305

nº de adesão NCBI

NM_198551

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MIA3(375056) , MIA3(375056)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jessica L Maiers et al.
Hepatology (Baltimore, Md.), 65(3), 983-998 (2017-01-01)
Fibrogenesis encompasses the deposition of matrix proteins, such as collagen I, by hepatic stellate cells (HSCs) that culminates in cirrhosis. Fibrogenic signals drive transcription of procollagen I, which enters the endoplasmic reticulum (ER), is trafficked through the secretory pathway, and
Yabo Li et al.
Journal of the American Heart Association, 9(7), e014146-e014146 (2020-04-03)
Background Epistasis describes how gene-gene interactions affect phenotypes, and could have a profound impact on human diseases such as coronary artery disease (CAD). The goal of this study was to identify gene-gene interactions in CAD using an easily generalizable multi-stage
Joan Chang et al.
Nature cell biology, 22(1), 74-86 (2020-01-08)
Collagen is the most abundant secreted protein in vertebrates and persists throughout life without renewal. The permanency of collagen networks contrasts with both the continued synthesis of collagen throughout adulthood and the conventional transcriptional/translational homeostatic mechanisms that replace damaged proteins

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica