Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU075161

Sigma-Aldrich

MISSION® esiRNA

targeting human SETD2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TCAGGAAAGGGATTTGCTTCCAGGGAGAACAGGCGTAATAATGGGTTATCTGGGAAATGTTTGCAAGAGGCTCAAGAAGAAGGGAATTCCATATTGCCTGAAAGAAGAGGAAGACCAGAAATCTCTTTAGATGAAAGAGGAGAAGGAGGACATGTGCATACTTCTGATGACTCAGAAGTTGTATTTTCTTCTTGTGATTTGAATTTAACCATGGAAGACAGTGATGGTGTAACTTATGCATTAAAGTGTGACAGTAGTGGTCATGCCCCAGAAATTGTGTCTACAGTTCATGAAGATTATTCTGGCTCTTCTGAAAGTTCAAATGATGAAAGTGATTCAGAAGATACAGATTCGGATGATAGCAGTATTCCAAGAAACCGTCTCCAGTCTGTTGTGGTTGTGCCAAAG

Ensembl | Número de adesão de ser humano

ENSG00000181555

nº de adesão NCBI

NM_014159

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SETD2(29072) , SETD2(29072)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

You Zhou et al.
Aging, 12(24), 25189-25206 (2020-11-24)
The histone H3 lysine 36 methyltransferase SET-domain-containing 2 (SETD2) has been reported to be frequently mutated or deleted in many types of human cancer. However, the role of SETD2 in lung adenocarcinoma (LUAD) has not been well documented. In the
Sergej Pirkmajer et al.
Frontiers in physiology, 11, 566584-566584 (2020-10-27)
The cardiotonic steroids (CTS), such as ouabain and marinobufagenin, are thought to be adrenocortical hormones secreted during exercise and the stress response. The catalytic α-subunit of Na,K-ATPase (NKA) is a CTS receptor, whose largest pool is located in skeletal muscles
A Rolfo et al.
Cell death & disease, 3, e305-e305 (2012-05-04)
The E3 ubiquitin ligase MULE (Mcl-1 Ubiquitin Ligases E3) targets myeloid cell leukemia factor 1 (Mcl-1) and tumor suppressor p53 for proteasomal degradation. Although Mcl-1 and p53 have been implicated in trophoblast cell death in preeclampsia (PE) and intrauterine growth
Na Liu et al.
Oncology reports, 32(6), 2397-2404 (2014-10-22)
Previously, we reported that hypoxia was able to induce invasion and metastasis in gastric cancer and that hypoxia-inducible factor-1 (HIF-1) is a key factor involved in this tumor type. Krüppel-like factor 8 (KLF8) as a transcriptional repressor has been suggested

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica