Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU068241

Sigma-Aldrich

MISSION® esiRNA

targeting human P2RX4

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATACACGGGACGTTGAGCACAACGTATCTCCTGGCTACAATTTCAGGTTTGCCAAGTACTACAGAGACCTGGCTGGCAACGAGCAGCGCACGCTCATCAAGGCCTATGGCATCCGCTTCGACATCATTGTGTTTGGGAAGGCAGGGAAATTTGACATCATCCCCACTATGATCAACATCGGCTCTGGCCTGGCACTGCTAGGCATGGCGACCGTGCTGTGTGACATCATAGTCCTCTACTGCATGAAGAAAAGACTCTACTATCGGGAGAAGAAATATAAATATGTGGAAGATTACGAGCAGGGTCTTGCTAGTGAGCTGGACCAGTGAGGCCTACCCCACACCTGGGCTCTCCACAGCCCCATCAAAGAACAGAGAGGAGGAGGAGGGAGAAATGGCCACCACATCACCCCAGAGAAATTTCTGGAATCTGATTGAGTCTCCACTCCACAAGCACTCA

Ensembl | Número de adesão de ser humano

ENSG00000135124

nº de adesão NCBI

NM_002560

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... P2RX4(5025) , P2RX4(5025)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jun-Feng Huo et al.
Journal of cellular biochemistry, 120(4), 6322-6329 (2018-10-27)
Purinergic receptor P2X 4 (P2X4R), a member of purinergic channels family and a subtype of ionotropic adenosine triphosphate receptors, plays a critical role in tumorigenesis. Evidence suggested that P2X4R is expressed in rat C6 glioma model, however, its role and
Larisa Gofman et al.
Alcohol and alcoholism (Oxford, Oxfordshire), 51(6), 647-654 (2016-10-30)
Previously we have demonstrated altered microglia P2X4R expression in response to alcohol and pharmacological blockade with a selective P2X4R antagonist can reverse the action, suggesting that P2X4R play a role in mediating alcohol-induced effects on microglia. In the present study
Dmitry Aminin et al.
Scientific reports, 6, 39683-39683 (2016-12-23)
Since ancient times, edible sea cucumbers have been considered a jewel of the seabed and used in Asian folk medicine for stimulation of resistance against different diseases. However, the power of this sea food has not been established on a
Xiao-Hong Jin et al.
Journal of neuroscience research, 92(12), 1690-1702 (2014-07-06)
Previous studies have suggested that the microglial P2X7 purinoceptor is involved in the release of tumor necrosis factor-α (TNFα) following activation of toll-like receptor-4 (TLR4), which is associated with nociceptive behavior. In addition, this progress is evoked by the activation

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica