Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU032191

Sigma-Aldrich

MISSION® esiRNA

targeting human GSDMD

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGTTCTGGAAACCCCGTTATAAGTGTGTCAACCTGTCTATCAAGGACATCCTGGAGCCGGATGCCGCGGAACCAGACGTGCAGCGTGGCAGGAGCTTCCACTTCTACGATGCCATGGATGGGCAGATACAGGGCAGCGTGGAGCTGGCAGCCCCAGGACAGGCAAAGATCGCAGGCGGGGCCGCGGTGTCTGACAGCTCCAGCACCTCAATGAATGTGTACTCGCTGAGTGTGGACCCTAACACCTGGCAGACTCTGCTCCATGAGAGGCACCTGCGGCAGCCAGAACACAAAGTCCTGCAGCAGCTGCGCAGCCGCGGGGACAACGTGTACGTGGTGACTGAGGTGCTGCAGACACAGAAGGAGGTGGAAGTCACGCGCACCCACAAGCGGGAGGGCTCGGGCCGGTTTTCCCTGCCCGGAGCCACGTGCTTGCAGGGTGAGGGCCAGGGCCATCTGAGCCAGAAGAAGACGGTC

Ensembl | Número de adesão de ser humano

ENSG00000104518

nº de adesão NCBI

NM_024736

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... GSDMD(79792) , GSDMD(79792)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
MAV

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Guangxue Gu et al.
International immunopharmacology, 91, 107227-107227 (2020-12-29)
Ankylosing spondylitis (AS) is a disease characterized by inflammation of the sacroiliac joint and the attachment point of the spine. This study aimed to investigate the effect of microRNA (miR)-204-targeted GSDMD on fibroblast-like synoviocytes (FLSs) in AS. miR-204, GSDMD, pyrolysis-related
Jianwei Gao et al.
Oncology reports, 40(4), 1971-1984 (2018-08-15)
Gasdermin D (GSDMD) is a newly discovered pyroptosis executive protein, which can be cleaved by inflammatory caspases and is essential for secretion of IL‑1β, making it a critical mediator of inflammation. However, the precise role of GSDMD in carcinogenesis remains nearly
Hui Chen et al.
Molecular neurodegeneration, 15(1), 26-26 (2020-04-17)
Acute glaucoma, characterized by a sudden elevation in intraocular pressure (IOP) and retinal ganglion cells (RGCs) death, is a major cause of irreversible blindness worldwide that lacks approved effective therapies, validated treatment targets and clear molecular mechanisms. We sought to
Wenyi Zhao et al.
Experimental eye research, 202, 108375-108375 (2020-12-07)
The protein GSDMD is an important performer of pyroptosis and a universal substrate for the inflammatory caspase. However, the role and regulatory mechanism of GSDMD in Aspergillus fumigatus keratitis is remains unknown. Here we detected GSDMD protein in the cornea

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica