Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU025841

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em02 de junho de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em02 de junho de 2025

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CGAATCCGCATGACTCATAATTTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGCCCTCACAAAGCCAATGCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAATTCTTGCGCTCCATCCGTCCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCAACGTTGGTGAGGACTGTCCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCAAGTGCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTGCACCATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCCATCCTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACA

Ensembl | Número de adesão de ser humano

ENSG00000116478

nº de adesão NCBI

NM_004964

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... HDAC1(3065) , HDAC1(3065)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
PPU
QCS
XUT
WUT
ZKT

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Soniya Bastola et al.
Nature communications, 11(1), 4660-4660 (2020-09-18)
Intratumor spatial heterogeneity facilitates therapeutic resistance in glioblastoma (GBM). Nonetheless, understanding of GBM heterogeneity is largely limited to the surgically resectable tumor core lesion while the seeds for recurrence reside in the unresectable tumor edge. In this study, stratification of
Jing Yang et al.
Scientific reports, 7, 43864-43864 (2017-03-07)
Hepatocellular carcinoma (HCC) is one of the most commonly diagnosed cancers in the world. Elevated glucose metabolism in the availability of oxygen, a phenomenon called the Warburg effect, is important for cancer cell growth. Fructose-1,6-bisphosphatase (FBP1) is a rate-limiting enzyme
Baojie Zhang et al.
Cancers, 11(5) (2019-05-15)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is considered as a promising anti-cancer therapeutic. However, many cancers have been found to be or to become inherently resistant to TRAIL. A combination of epigenetic modifiers, such as histone deacetylase inhibitors (HDACi's), with
Chaojie Hu et al.
Journal of leukocyte biology, 101(3), 633-642 (2016-06-05)
Binge drinking represses host innate immunity and leads to a high risk of infection. Acute EtOH-pretreated macrophages exhibit a decreased production of proinflammatory mediators in response to LPS. ATF3 is induced and counter-regulates the LPS/TLR4 inflammatory cascade. Here, we investigated
Sin Y Choi et al.
Journal of cellular and molecular medicine, 20(12), 2289-2298 (2016-07-16)
Epithelial-mesenchymal transition (EMT) and renal fibrosis are closely involved in chronic kidney disease. Inhibition of histone deacetylase (HDAC) has an anti-fibrotic effect in various diseases. However, the pathophysiological role of isoform-specific HDACs or class-selective HDACs in renal fibrosis remains unknown.
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica