Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU084261

Sigma-Aldrich

MISSION® esiRNA

targeting human PFKM

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGTGTCCAGGTGACCAAAGATGTGACCAAGGCCATGGATGAGAAGAAATTTGACGAAGCCCTGAAGCTGAGAGGCCGGAGCTTCATGAACAACTGGGAGGTGTACAAGCTTCTAGCTCATGTCAGACCCCCGGTATCTAAGAGTGGTTCGCACACAGTGGCTGTGATGAACGTGGGGGCTCCGGCTGCAGGCATGAATGCTGCTGTTCGCTCCACTGTGAGGATTGGCCTTATCCAGGGCAACCGAGTGCTCGTTGTCCATGATGGTTTCGAGGGCCTGGCCAAGGGGCAGATAGAGGAAGCTGGCTGGAGCTATGTTGGGGGCTGGACTGGCCAAGGTGGCTCTAAACTTGGGACTAAAAGGACTCTACCCAAGAAGAGCTTTGAACAGATCAGTGCCAATATAACTAAGTTTAACATTCAGGGCCTTGTCATC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Rui-Fang Tian et al.
American journal of translational research, 12(9), 4923-4940 (2020-10-13)
This study explored the effects of phosphofructokinase-1 (PFK1) on the radiosensitivity of colorectal cancer (CRC) in vivo and in vitro and the underlying mechanisms. Tissue samples from 48 patients with rectal cancer who had received neoadjuvant radiotherapy followed by surgery
Jinling Cui et al.
Journal of agricultural and food chemistry, 67(38), 10637-10645 (2019-09-13)
Previous studies have shown that selenite, a representative of inorganic form selenium, exerts its anticancer effect by inducing apoptosis in androgen-dependent LNCaP prostate cancer cells, but few studies have determined the nature of cell death induced by selenite in metastatic

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique