Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU066711

Sigma-Aldrich

MISSION® esiRNA

targeting human BMX

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGAGGCCCAGACTATGATGAAACTCAGCCATCCCAAGCTGGTTAAATTCTATGGAGTGTGTTCAAAGGAATACCCCATATACATAGTGACTGAATATATAAGCAATGGCTGCTTGCTGAATTACCTGAGGAGTCACGGAAAAGGACTTGAACCTTCCCAGCTCTTAGAAATGTGCTACGATGTCTGTGAAGGCATGGCCTTCTTGGAGAGTCACCAATTCATACACCGGGACTTGGCTGCTCGTAACTGCTTGGTGGACAGAGATCTCTGTGTGAAAGTATCTGACTTTGGAATGACAAGGTATGTTCTTGATGACCAGTATGTCAGTTCAGTCGGAACAAAGTTTCCAGTCAAGTGGTCAGCTCCAGAGGTGTTTCATTACTTCAAATACAGCAGCAAGTCAGACGTATGGGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... BMX(660) , BMX(660)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ting Wei et al.
American journal of cancer research, 7(3), 628-646 (2017-04-13)
miR-495 serves as an oncogenic miRNA or a tumor suppressor in different types of cancer. However, its role in the drug resistance of small cell lung cancer (SCLC) remains unidentified. In this study, we investigated whether miR-495 regulates the chemoresistance
Lesley A Mathews et al.
Molecular cancer, 9, 267-267 (2010-10-12)
Recently, much attention has been focused on gaining a better understanding of the different populations of cells within a tumor and their contribution to cancer progression. One of the most commonly used methods to isolate a more aggressive sub-population of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique