Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU113241

Sigma-Aldrich

MISSION® esiRNA

targeting human G3BP1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GAGCCTCAGGAGGAGTCTGAAGAAGAAGTAGAGGAACCTGAAGAAAGACAGCAAACACCTGAGGTGGTACCTGATGATTCTGGAACTTTCTATGATCAGGCAGTTGTCAGTAATGACATGGAAGAACATTTAGAGGAGCCTGTTGCTGAACCAGAGCCTGATCCTGAACCAGAACCAGAACAAGAACCTGTATCTGAAATCCAAGAGGAAAAGCCTGAGCCAGTATTAGAAGAAACTGCCCCTGAGGATGCTCAGAAGAGTTCTTCTCCAGCACCTGCAGACATAGCTCAGACAGTACAGGAAGACTTGAGGACATTTTCTTGGGCATCTGTGACCAGTAAGAATCTTCCACCCAGTGGAGCTGTTCCAGTTACTGGGATACCACCTCATGTTGTTAAAGTACCAGCTTCACAGCCC

Ensembl | Human Hinterlegungsnummer

ENSG00000145907

NCBI-Hinterlegungsnummer

NM_005754

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... G3BP1(10146) , G3BP1(10146)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ning Dou et al.
American journal of cancer research, 6(11), 2641-2650 (2016-12-03)
RasGAP SH3-domain-Binding Protein 1 (G3BP1) has been implicated in cell growth, migration, and metastasis of some cancers, yet its function in hepatocellular carcinoma (HCC) remains to be explored. In the present study, we reported that G3BP1 was upregulated in HCC
Amr Omer et al.
EMBO reports, 19(5) (2018-03-30)
Cellular senescence is a physiological response by which an organism halts the proliferation of potentially harmful and damaged cells. However, the accumulation of senescent cells over time can become deleterious leading to diseases and physiological decline. Our data reveal a
Amr Omer et al.
Nature communications, 11(1), 4979-4979 (2020-10-07)
Cellular senescence is a known driver of carcinogenesis and age-related diseases, yet senescence is required for various physiological processes. However, the mechanisms and factors that control the negative effects of senescence while retaining its benefits are still elusive. Here, we
Allison B Herman et al.
Arteriosclerosis, thrombosis, and vascular biology, 39(10), 2014-2027 (2019-08-30)
Stress granules (SGs) are dynamic cytoplasmic aggregates containing mRNA, RNA-binding proteins, and translation factors that form in response to cellular stress. SGs have been shown to contribute to the pathogenesis of several human diseases, but their role in vascular diseases
David Pla-Martín et al.
The EMBO journal, 39(9), e102731-e102731 (2020-03-10)
Mitochondria house anabolic and catabolic processes that must be balanced and adjusted to meet cellular demands. The RNA-binding protein CLUH (clustered mitochondria homolog) binds mRNAs of nuclear-encoded mitochondrial proteins and is highly expressed in the liver, where it regulates metabolic

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.