Direkt zum Inhalt
Merck

EHU084871

Sigma-Aldrich

MISSION® esiRNA

targeting human JAK1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGAAATGCCTGGCTCCTATTCGAGACCCCAAGACCGAGCAGGATGGACATGATATTGAGAACGAGTGTCTAGGGATGGCTGTCCTGGCCATCTCACACTATGCCATGATGAAGAAGATGCAGTTGCCAGAACTGCCCAAGGACATCAGCTACAAGCGATATATTCCAGAAACATTGAATAAGTCCATCAGACAGAGGAACCTTCTCACCAGGATGCGGATAAATAATGTTTTCAAGGATTTCCTAAAGGAATTTAACAACAAGACCATTTGTGACAGCAGCGTGTCCACGCATGACCTGAAGGTGAAATACTTGGCTACCTTGGAAACTTTGACAAAACATTACGGTGCTGAAATATTTGAGACTTCCATGTTACTGATTTCATCAGAAAATGAGATGAATTGGTTTCATTCGAATGACGGTGGAAACGTTCTC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Matija Hedl et al.
Journal of immunology (Baltimore, Md. : 1950), 197(9), 3695-3704 (2016-09-25)
JAK2 genetic variants are associated with inflammatory bowel disease (IBD) and JAK inhibitors are being evaluated for therapy targeting immune-mediated diseases, including IBD. As JAK pathway-mediated cytokine regulation varies across cell types and stimulation conditions, we examined how JAK signaling
Han Liu et al.
Oncotarget, 8(24), 38113-38135 (2017-05-13)
Human colon cancers express higher levels of NADPH oxidase 1 [NOX1] than adjacent normal epithelium. It has been suggested that reactive oxygen species [ROS] derived from NOX1 contribute to DNA damage and neoplastic transformation in the colon, particularly during chronic
Li-Chuan Chan et al.
The Journal of clinical investigation, 129(8), 3324-3338 (2019-07-16)
Glycosylation of immune receptors and ligands, such as T cell receptor and coinhibitory molecules, regulates immune signaling activation and immune surveillance. However, how oncogenic signaling initiates glycosylation of coinhibitory molecules to induce immunosuppression remains unclear. Here we show that IL-6-activated
Elisabeth Losdyck et al.
The Journal of biological chemistry, 290(48), 29022-29034 (2015-10-09)
JAK1 and JAK3 are recurrently mutated in acute lymphoblastic leukemia. These tyrosine kinases associate with heterodimeric cytokine receptors such as IL-7 receptor or IL-9 receptor, in which JAK1 is appended to the specific chain, and JAK3 is appended to the

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.