Direkt zum Inhalt
Merck
Alle Fotos(2)

Dokumente

EHU051011

Sigma-Aldrich

MISSION® esiRNA

targeting human PLK1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(2)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGCAACCTTTTCCTGAATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAAGTCGAATATGACGGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCCGAGGTGCTGAGCAAGAAAGGGCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTATCATGTATACCTTGTTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAAAGAGACCTACCTCCGGATCAAGAAGAATGAATACAGTATTCCCAAGCACATCAACCCCGTGGCCGCCTCCCTCATCCAGAAGATGCTTCAGACAGATCCCACTGCCCGCCCAACCATTAACGAGCTGCT

Ensembl | Human Hinterlegungsnummer

ENSG00000166851

NCBI-Hinterlegungsnummer

NM_005030

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... PLK1(5347) , PLK1(5347)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jinhua Dong et al.
Biotechnology and bioengineering, 117(5), 1259-1269 (2020-02-11)
Ultra Quenchbody (UQ-body) is a biosensor that utilizes the quenching behavior of the fluorescent dye linked to the antibody V region. When the corresponding antigen is bound to the UQ-body, the fluorescence is restored and allows the detection of target
Owen Addis Jones et al.
Nature communications, 10(1), 2861-2861 (2019-06-30)
Centromeres provide a pivotal function for faithful chromosome segregation. They serve as a foundation for the assembly of the kinetochore complex and spindle connection, which is essential for chromosome biorientation. Cells lacking Polo-like kinase 1 (PLK1) activity suffer severe chromosome alignment
Hui Shi et al.
International journal of nanomedicine, 15, 3347-3362 (2020-06-05)
Temozolomide (TMZ) is the first-line chemotherapeutic option to treat glioma; however, its efficacy and clinical application are limited by its drug resistance properties. Polo-like kinase 1 (PLK1)-targeted therapy causes G2/M arrest and increases the sensitivity of glioma to TMZ. Therefore
Tomonori Higuchi et al.
Scientific reports, 7(1), 11026-11026 (2017-09-10)
The genetic events that lead to aggressive transformation of cases of splenic marginal zone lymphoma (SMZL) after the chronic clinical stage have not been well understood. We aimed to find candidate genes associated with aggressive features of SMZL. We have
James C Evans et al.
Molecular pharmaceutics, 14(1), 42-52 (2017-01-04)
In recent years, RNA interference (RNAi) has emerged as a potential therapeutic offering the opportunity to treat a wide range of diseases, including prostate cancer. Modified cyclodextrins have emerged as effective gene delivery vectors in a range of disease models.
Alle zugehörigen Dokumente anzeigen

Artikel

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.