Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EMU036041

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ripk1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGATGCACGTGCTAAAGACCCAGATAGATGTCCCACTTTCATTGAAAGGAAGGATAATCGTGGAGGCCATAGAAGGCATGTGCTACTTACATGACAAAGGTGTGATACACAAGGACCTGAAGCCTGAGAATATCCTCGTTGATCGTGACTTTCACATTAAGATAGCCGATCTTGGTGTGGCTTCCTTTAAGACATGGAGCAAACTGACTAAGGAGAAAGACAACAAGCAGAAAGAAGTGAGCAGCACCACTAAGAAGAACAATGGTGGTACCCTTTACTACATGGCACCCGAACACCTGAATGACATCAATGCAAAGCCCACGGAGAAGTCGGACGTGTACAGCTTTGGCATTGTCCTTTGGGCAATATTTGCAAAAAAGGAGCCCTATGAGAATGTCATCTGTACTGAGCAGTTCGTGATCTGCATAAAATCTGGGAACAGGCCAAATGTAGAGGAAATCCTTGAGTACTGTCCAAGGGAGATCATCAGC

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000021408

numer dostępu NCBI

NM_009068

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... RIPK1(19766) , Ripk1(19766)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yuichi Miki et al.
Lasers in medical science, 30(6), 1739-1745 (2015-06-26)
Photodynamic therapy (PDT) using photosensitizer induces several types of cell death, such as apoptosis, necrosis, and autophagy, depending on the PDT procedure, photosensitizer type, and cell type. We previously demonstrated that PDT using the photosensitizer talaporfin sodium (mono-L-aspartyl chlorine e6
Yoshiko Kaku et al.
Cellular signalling, 27(9), 1713-1719 (2015-05-26)
The present study investigated 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE)-induced cell death in malignant pleural mesothelioma (MPM) cells. DAPE reduced cell viability in NCI-H28, NCI-H2052, NCI-H2452, and MSTO-211H MPM cell lines in a concentration (1-100μM)-dependent manner. In the flow cytometry using propidium iodide (PI)
W He et al.
Oncogene, 33(23), 3004-3013 (2013-07-09)
Killing cancer cells through the induction of apoptosis is one of the main mechanisms of chemotherapy. However, numerous cancer cells have primary or acquired apoptosis resistance, resulting in chemoresistance. In this study, using a novel chalcone derivative chalcone-24 (Chal-24), we
H Schoeneberger et al.
Oncogene, 34(31), 4032-4043 (2014-11-11)
Evasion of apoptosis in pediatric acute lymphoblastic leukemia (ALL) is linked to aberrant expression of inhibitor of apoptosis (IAP) proteins and dysregulated redox homeostasis, rendering leukemic cells vulnerable to redox-targeting therapies. Here we discover that inhibition of antioxidant defenses via
Pedram Kharaziha et al.
Oncotarget, 6(35), 37066-37082 (2015-09-30)
Autophagy is one of the main cytoprotective mechanisms that cancer cells deploy to withstand the cytotoxic stress and survive the lethal damage induced by anti-cancer drugs. However, under specific conditions, autophagy may, directly or indirectly, induce cell death. In our
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej