Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU140621

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF5

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGTCAGTTGGGCCTTCATAAACACTCACCTGGCTGGCTTTGCCTTCCAGGAGGAAGCTGGCTGAAGCAAGGGTGTGGAATTTTAAATGTGTGCACAGTCTGGAAAACTGTCAGAATCAGTTTTCCCATAAAAGGGTGGGCTAGCATTGCAGCTGCATTTGGGACCATTCAAATCTGTCACTCTCTTGTGTATATTCCTGTGCTATTAAATATATCAGGGCAGTGCATGTAAATCATCCTGATATATTTAATATATTTATTATATTGTCCCCCGAGGTGGGGACAGTGAGTGAGTTCTCTTAGTCCCCCCAGAGCTGGTTGTTAAAGAGCCTGGCACCTACCCGCTCTCACTTCATCTGTGTCATCTCTGCACACTCCAGCCCACTTTCTGCCTTCAGCCAT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000128604

numer dostępu NCBI

NM_001098627

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... IRF5(3663) , IRF5(3663)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Kang Sun et al.
World journal of gastroenterology, 22(42), 9368-9377 (2016-11-30)
To investigate the role of interferon regulatory factor 5 (IRF5) in reversing polarization of lung macrophages during severe acute pancreatitis (SAP) A mouse SAP model was established by intraperitoneal (ip) injections of 20 μg/kg body weight caerulein. Pathological changes in
Hongbin Cai et al.
Biochemical and biophysical research communications, 492(2), 192-198 (2017-08-19)
Ischemia-reperfusion injury (IRI) has been implicated in many pathological conditions, including cardiovascular diseases. Adhesion of leukocytes to the surface of endothelial cells has been considered as one of the principle steps in the pathological cascade of inflammatory tissue damage during
Matija Hedl et al.
Journal of immunology (Baltimore, Md. : 1950), 202(3), 920-930 (2018-12-30)
Common IFN regulatory factor 5 (IRF5) variants associated with multiple immune-mediated diseases are a major determinant of interindividual variability in pattern recognition receptor (PRR)-induced cytokines in macrophages. PRR-initiated pathways also contribute to bacterial clearance, and dysregulation of bacterial clearance can
Jie Yan et al.
Journal of immunology (Baltimore, Md. : 1950), 205(4), 1024-1038 (2020-07-22)
Common IRF5 genetic risk variants associated with multiple immune-mediated diseases are a major determinant of interindividual variability in pattern-recognition receptor (PRR)-induced cytokines in myeloid cells. However, how myeloid cell-intrinsic IRF5 regulates the multiple distinct checkpoints mediating T cell outcomes in
Jihyun Yang et al.
Journal of cellular physiology, 234(12), 23033-23042 (2019-05-28)
Bone-resorbing osteoclasts are differentiated from macrophages (MΦ) by M-CSF and RANKL. MΦ can be mainly classified into M1 and M2 MΦ, which are proinflammatory and anti-inflammatory, respectively, but little is known about their osteoclastogenic potential. Here, we investigated the osteoclastogenic
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej