Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU076241

Sigma-Aldrich

MISSION® esiRNA

targeting human ERG

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CGGGGAAGAGATCCAAAGACTCTTGGGAGGGAGTTACTGAAGTCTTACTACAGAAATGAGGAGGATGCTAAAAATGTCACGAATATGGACATATCATCTGTGGACTGACCTTGTAAAAGACAGTGTATGTAGAAGCATGAAGTCTTAAGGACAAAGTGCCAAAGAAAGTGGTCTTAAGAAATGTATAAACTTTAGAGTAGAGTTTGGAATCCCACTAATGCAAACTGGGATGAAACTAAAGCAATAGAAACAACACAGTTTTGACCTAACATACCGTTTATAATGCCATTTTAAGGAAAACTACCTGTATTTAAAAATAGAAACATATCAAAAACAAGAGAAAAGACACGAGAGAGACTGTGGCCCATCAACAGACGTTGATATGCAACTGCATGGCATGTGCTGTTTTGGTTGAAATCAAATACATTCCGTTTGATGGACAGCT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000157554

numer dostępu NCBI

NM_182918

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... ERG(2078) , ERG(2078)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Rohit Bose et al.
Nature, 546(7660), 671-675 (2017-06-15)
Half of all prostate cancers are caused by the TMPRSS2-ERG gene-fusion, which enables androgens to drive expression of the normally silent E26 transformation-specific (ETS) transcription factor ERG in prostate cells. Recent genomic landscape studies of such cancers have reported recurrent
Chun-Wu Pan et al.
Theranostics, 11(4), 1780-1794 (2021-01-08)
Rationale: Enhancer RNA (eRNA) bi-directionally expresses from enhancer region and sense eRNA regulates adjacent mRNA in cis and in trans. However, it has remained unclear whether antisense eRNAs in different direction are functional or merely a reflection of enhancer activation.
Abdullah A Assiri et al.
Cancer genomics & proteomics, 16(6), 433-442 (2019-10-30)
hERG potassium channels enhance tumor invasiveness and breast cancer proliferation. MicroRNA (miRNA) dysregulation during cancer controls gene regulation. The objective of this study was to identify miRNAs that regulate hERG expression in breast cancer. Putative miRNAs targeting hERG were identified
Jung-Sun Kim et al.
Endocrinology, 155(9), 3262-3273 (2014-06-14)
A number of preclinical studies have shown that the activation of the vitamin D receptor (VDR) reduces prostate cancer (PCa) cell and tumor growth. The majority of human PCas express a transmembrane protease serine 2 (TMPRSS2):erythroblast transformation-specific (ETS) fusion gene
J Kim et al.
Oncogene, 33(44), 5183-5192 (2013-11-05)
Chromosomal translocations that juxtapose the androgen-sensitive transmembrane protease, serine 2 (TMPRSS2) gene promoter to the oncogenic ETS-family transcription factor ERG result in excessive ERG overexpression in approximately 50% of prostate cancer (PCa) patients. Although numerous studies have investigated ERG-downstream genes
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej