Przejdź do zawartości
Merck

EHU008731

Sigma-Aldrich

MISSION® esiRNA

targeting human NR4A2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCCAGTGGAGGGTAAACTCATCTTTTGCAATGGGGTGGTCTTGCACAGGTTGCAATGCGTTCGTGGCTTTGGGGAATGGATTGATTCCATTGTTGAATTCTCCTCCAACTTGCAGAATATGAACATCGACATTTCTGCCTTCTCCTGCATTGCTGCCCTGGCTATGGTCACAGAGAGACACGGGCTCAAGGAACCCAAGAGAGTGGAAGAACTGCAAAACAAGATTGTAAATTGTCTCAAAGACCACGTGACTTTCAACAATGGGGGGTTGAACCGCCCCAATTATTTGTCCAAACTGTTGGGGAAGCTCCCAGAACTTCGTACCCTTTGCACACAGGGGCTACAGCGCATTTTCTACCTGAAATTGGAAGACTTGGTGCCACCGCCAGCAATAATTGACAAACTTTTCCTGGACACTTTACCTTTCTAAGACCTCCTCCCAAGCACTTCAAAGGAACTGGAATGATAATGGAAACTGTCAAGAGGGGGCAAGTCACATGGGCAGAGATAGCCGTGTGAGCAGTCTCAGCTC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

12 - Non Combustible Liquids

Klasa zagrożenia wodnego (WGK)

WGK 1

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Soo Min Kim et al.
Molecules and cells, 43(6), 551-571 (2020-06-12)
Nuclear receptor-related 1 (Nurr1) protein has been identified as an obligatory transcription factor in midbrain dopaminergic neurogenesis, but the global set of human NURR1 target genes remains unexplored. Here, we identified direct gene targets of NURR1 by analyzing genome-wide differential
Shawn Llopis et al.
BMC cancer, 13, 139-139 (2013-03-23)
NR4A orphan nuclear receptors are involved in multiple biological processes which are important in tumorigenesis such as cell proliferation, apoptosis, differentiation, and glucose utilization. The significance of NR4A family member NURR1 (NR4A2) in breast cancer etiology has not been elucidated.
Xin Heng et al.
Molecular neurodegeneration, 7, 4-4 (2012-02-03)
NURR1 (also named as NR4A2) is a member of the steroid/thyroid hormone receptor family, which can bind to DNA and modulate expression of target genes. Previous studies have shown that NURR1 is essential for the nigral dopaminergic neuron phenotype and
Masanori Nagaoka et al.
Journal of immunology (Baltimore, Md. : 1950), 199(8), 2958-2967 (2017-09-13)
NR4A3/NOR1 belongs to the NR4A subfamily of the nuclear hormone receptor superfamily, which is activated in a ligand-independent manner. To examine the role of NR4A3 in gene expression of dendritic cells (DCs), we introduced NR4A3 small interfering RNA (siRNA) into
S Loppi et al.
Brain, behavior, and immunity, 73, 670-681 (2018-08-01)
Ischemic stroke is amongst the leading causes of death and disabilities. The available treatments are suitable for only a fraction of patients and thus novel therapies are urgently needed. Blockage of one of the cerebral arteries leads to massive and

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej