추천 제품
![Tricyclo[5.2.1.02,6]decanedimethanol diacrylate](/deepweb/assets/sigmaaldrich/product/structures/327/536/0dc81542-b920-47ec-99c1-d064a327a315/640/0dc81542-b920-47ec-99c1-d064a327a315.png)
![2-[[(Butylamino)carbonyl]oxy]ethyl acrylate](/deepweb/assets/sigmaaldrich/product/structures/603/008/4241c20d-94e8-474e-b3ff-6c4d5be67e9d/640/4241c20d-94e8-474e-b3ff-6c4d5be67e9d.png)
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AACCGAACCACTCCAAGCTATGTCGCCTTTACGGACACTGAACGGTTGATCGGTGATGCCGCAAAGAATCAAGTTGCAATGAACCCCACCAACACAGTTTTTGATGCCAAACGTCTGATTGGACGCAGATTTGATGATGCTGTTGTCCAGTCTGATATGAAACATTGGCCCTTTATGGTGGTGAATGATGCTGGCAGGCCCAAGGTCCAAGTAGAATACAAGGGAGAGACCAAAAGCTTCTATCCAGAGGAGGTGTCTTCTATGGTTCTGACAAAGATGAAGGAAATTGCAGAAGCCTACCTTGGGAAGACTGTTACCAATGCTGTGGTCACAGTGCCAGCTTACTTTAATGACTCTCAGCGTCAGGCTACCAAAGATGCTGGAACTATTGCTGGTCTCAATGTACTTAGAATTATTAATGAGCCAACTGCTGCTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... HSPA8(3312) , HSPA8(3312)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Midori Ikezaki et al.
Biochemical and biophysical research communications, 527(2), 481-488 (2020-04-28)
Heat-shock cognate protein 70 (Hsc70), a molecular chaperone, is involved in multiple cellular functions. We previously demonstrated that Hsc70 is required for TGF-β-induced Smad signaling in mesenchymal-like NRK-49F cells. In the present study, to compare the Hsc70 functions in TGF-β-related
Guan Sun et al.
Neuromolecular medicine, 21(1), 33-41 (2019-01-05)
Heat shock cognate protein 70 (Hsc70) is a key mediator for the maintenance of intracellular proteins and regulates cellular activities. And it is elevated in various tumor tissues including glioma, which is closely related to the malignancy and poor prognosis
Ximeng Yang et al.
Scientific reports, 8(1), 11707-11707 (2018-08-05)
We previously found diosgenin, an herbal drug-derived steroid sapogenin, to be remarkably effective at restoring Aβ-induced axonal degeneration and improving memory function in model of Alzheimer's disease (AD), 5XFAD mouse. In this study, we investigated the downstream signaling of diosgenin
Guan Sun et al.
Journal of cellular biochemistry, 120(6), 10707-10714 (2019-03-01)
Migration and invasion are often recognized as the main reasons for the high recurrence and death rates of glioma and limit the efficacy of surgery and other antitumor therapies. In this study, we found over activation of heat shock cognate
Nerea Allende-Vega et al.
Scientific reports, 9(1), 5637-5637 (2019-04-06)
Eliminating mutant p53 (mt p53) protein could be a useful strategy to treat mt p53 tumors and potentially improve the prognosis of cancer patients. In this study, we unveil different mechanisms that eliminate p53-R248Q, one of the most frequent mutants
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
