Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU131291

Sigma-Aldrich

MISSION® esiRNA

targeting human MTA1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATGGAGGAGTGGTCTGCATCAGAGGCCAACCTTTTCGAGGAAGCCCTGGAAAAATATGGGAAGGATTTCACGGACATTCAGCAAGATTTTCTCCCGTGGAAGTCGCTGACCAGCATCATTGAGTACTACTACATGTGGAAGACCACCGACAGATACGTGCAGCAGAAACGCTTGAAAGCAGCTGAAGCTGAGAGCAAGTTAAAGCAAGTTTATATTCCCAACTATAACAAGCCAAATCCGAACCAAATCAGCGTCAACAACGTCAAGGCCGGTGTGGTGAACGGCACGGGGGCGCCGGGCCAGAGCCCTGGGGCTGGCCGGGCCTGCGAGAGCTGTTACACCACACAGTCTTACCAGTGGTATTCTTGGGGTCCCCCTAACATGCAGTGTCGTCTCTGCGCATCTTGTTGGACATATTGGAAGAAATATGGTGGCTTGAAAATGCCAACCCGGTTAGATGGAGAGAGGCCAGGA

N° accesso Ensembl | uomo

ENSG00000182979

N° accesso NCBI

NM_004689

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... MTA1(9112) , MTA1(9112)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

S Deivendran et al.
Scientific reports, 7, 44225-44225 (2017-04-11)
Despite a recognized role of DNA methyltransferase 3a (DNMT3a) in human cancer, the nature of its upstream regulator(s) and relationship with the master chromatin remodeling factor MTA1, continues to be poorly understood. Here, we found an inverse relationship between the
Yongqin Pan et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 83, 1398-1406 (2016-10-25)
Dysregulation of microRNAs is involved in the initiation and progression of several human cancers, including breast cancer, as strong evidence of miRNAs acting as oncogenes or tumour suppressor genes has been found. This study was performed to investigate the biological
Wenhao Weng et al.
International journal of oncology, 44(3), 812-818 (2014-01-16)
Esophageal squamous cell carcinoma (ESCC) is one of the most common malignant tumors. Upregulation of metastasis-associated protein 1 (MTA1) has been reported to contribute to the development of esophageal squamous cell carcinoma. Therefore, the objective of our study was to identify
Hong Zhang et al.
Acta biochimica et biophysica Sinica, 47(7), 496-503 (2015-05-23)
Metastasis-associated gene 1 (MTA1) is associated with cell growth, metastasis, and survival in non-small-cell lung cancer (NSCLC). Several previous reports have demonstrated that microRNAs affect gene expression through interaction between their seed region and the 3'-untranslated region of the target
Ioannis Sanidas et al.
Molecular cell, 73(5), 985-1000 (2019-02-04)
Hyper-phosphorylation of RB controls its interaction with E2F and inhibits its tumor suppressor properties. However, during G1 active RB can be mono-phosphorylated on any one of 14 CDK phosphorylation sites. Here, we used quantitative proteomics to profile protein complexes formed

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.