EHURLUC
MISSION® esiRNA
targeting RLUC
Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
About This Item
Codice UNSPSC:
41105324
NACRES:
NA.51
Prodotti consigliati
Descrizione
Powered by Eupheria Biotech
Livello qualitativo
Nome Commerciale
MISSION®
Stato
lyophilized powder
Condizioni di spedizione
ambient
Temperatura di conservazione
−20°C
Descrizione generale
EHURLUC targets Renilla Luciferase. It can be used as a negative control in systems lacking Renilla Luciferase, or a positive knockdown control in systems expressing it.
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Altre note
esiRNA cDNA target sequence: GATAACTGGTCCGCAGTGGTGGGCCAGATGTAAACAAATGAATGTTCTTGATTCATTTATTAATTATTATGATTCAGAAAAACATGCAGAAAATGCTGTTATTTTTTTACATGGTAACGCGGCCTCTTCTTATTTATGGCGACATGTTGTGCCACATATTGAGCCAGTAGCGCGGTGTATTATACCAGACCTTATTGGTATGGGCAAATCAGGCAAATCTGGTAATGGTTCTTATAGGTTACTTGATCATTACAAATATCTTACTGCATGGTTTGAACTTCTTAATTTACCAAAGAAGATCATTTTTGTCGGCCATGATTGGGGTGCTTGTTTGGCATTTCATTATAGCTATGAGCATCAAGATAAGATCAAAGCAATAGTTCACGCTGAAAGTGTAGTAGATGTGATTGAATCATGGGATGAATGG
Note legali
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Non trovi il prodotto giusto?
Prova il nostro Motore di ricerca dei prodotti.
Codice della classe di stoccaggio
10 - Combustible liquids
Classe di pericolosità dell'acqua (WGK)
WGK 1
Punto d’infiammabilità (°F)
Not applicable
Punto d’infiammabilità (°C)
Not applicable
Scegli una delle versioni più recenti:
Possiedi già questo prodotto?
I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.
I clienti hanno visto anche
Rachel Elizabeth Miller et al.
Biochemical and biophysical research communications, 500(2), 391-397 (2018-04-15)
PPM1B is a metal-dependent serine/threonine protein phosphatase, with a similar structure and function to the well-known oncogene in breast cancer, PPM1D (WIP1). However, clinical significance of PPM1B as a pharmacological target in cancer therapy has not been explored. To test
6-Dehydrogingerdione restrains lipopolysaccharide-induced inflammatory responses in RAW 264.7 macrophages.
Huang SH, Lee CH, Wang HM, et al.
Journal of Agricultural and Food Chemistry, 62(37), 9171-9179 (2014)
Laura R Hardy et al.
Oncogene, 38(32), 6003-6016 (2019-07-13)
High grade serous ovarian cancer (HGSOC) is the fifth leading cause of cancer deaths among women yet effective targeted therapies against this disease are limited. The heterogeneity of HGSOC, including few shared oncogenic drivers and origination from both the fallopian
Jonasz J Weber et al.
Human molecular genetics, 29(6), 892-906 (2020-01-22)
Proteolytic fragmentation of polyglutamine-expanded ataxin-3 is a concomitant and modifier of the molecular pathogenesis of Machado-Joseph disease (MJD), the most common autosomal dominant cerebellar ataxia. Calpains, a group of calcium-dependent cysteine proteases, are important mediators of ataxin-3 cleavage and implicated
Jonasz Jeremiasz Weber et al.
Neuropharmacology, 133, 94-106 (2018-01-23)
Deciphering the molecular pathology of Huntington disease is of particular importance, not only for a better understanding of this neurodegenerative disease, but also to identify potential therapeutic targets. The polyglutamine-expanded disease protein huntingtin was shown to undergo proteolysis, which results
Articoli
esiRNA are endoribonuclease prepared siRNAs that target the same mRNA sequence for gene silencing. Here are some of the most asked questions regarding esiRNA uses and availability.
Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..
Contatta l'Assistenza Tecnica.