Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU115141

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPA8

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AACCGAACCACTCCAAGCTATGTCGCCTTTACGGACACTGAACGGTTGATCGGTGATGCCGCAAAGAATCAAGTTGCAATGAACCCCACCAACACAGTTTTTGATGCCAAACGTCTGATTGGACGCAGATTTGATGATGCTGTTGTCCAGTCTGATATGAAACATTGGCCCTTTATGGTGGTGAATGATGCTGGCAGGCCCAAGGTCCAAGTAGAATACAAGGGAGAGACCAAAAGCTTCTATCCAGAGGAGGTGTCTTCTATGGTTCTGACAAAGATGAAGGAAATTGCAGAAGCCTACCTTGGGAAGACTGTTACCAATGCTGTGGTCACAGTGCCAGCTTACTTTAATGACTCTCAGCGTCAGGCTACCAAAGATGCTGGAACTATTGCTGGTCTCAATGTACTTAGAATTATTAATGAGCCAACTGCTGCTG

N° accesso Ensembl | uomo

ENSG00000109971

N° accesso NCBI

NM_006597

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... HSPA8(3312) , HSPA8(3312)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
EDV
BBV
XDU
YRS
WGT

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Midori Ikezaki et al.
Biochemical and biophysical research communications, 527(2), 481-488 (2020-04-28)
Heat-shock cognate protein 70 (Hsc70), a molecular chaperone, is involved in multiple cellular functions. We previously demonstrated that Hsc70 is required for TGF-β-induced Smad signaling in mesenchymal-like NRK-49F cells. In the present study, to compare the Hsc70 functions in TGF-β-related
Guan Sun et al.
Neuromolecular medicine, 21(1), 33-41 (2019-01-05)
Heat shock cognate protein 70 (Hsc70) is a key mediator for the maintenance of intracellular proteins and regulates cellular activities. And it is elevated in various tumor tissues including glioma, which is closely related to the malignancy and poor prognosis
Ximeng Yang et al.
Scientific reports, 8(1), 11707-11707 (2018-08-05)
We previously found diosgenin, an herbal drug-derived steroid sapogenin, to be remarkably effective at restoring Aβ-induced axonal degeneration and improving memory function in model of Alzheimer's disease (AD), 5XFAD mouse. In this study, we investigated the downstream signaling of diosgenin
Guan Sun et al.
Journal of cellular biochemistry, 120(6), 10707-10714 (2019-03-01)
Migration and invasion are often recognized as the main reasons for the high recurrence and death rates of glioma and limit the efficacy of surgery and other antitumor therapies. In this study, we found over activation of heat shock cognate
Nerea Allende-Vega et al.
Scientific reports, 9(1), 5637-5637 (2019-04-06)
Eliminating mutant p53 (mt p53) protein could be a useful strategy to treat mt p53 tumors and potentially improve the prognosis of cancer patients. In this study, we unveil different mechanisms that eliminate p53-R248Q, one of the most frequent mutants
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.