Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU092591

Sigma-Aldrich

MISSION® esiRNA

targeting human ATF3 (1)

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Per informazioni sulla disponibilità, contatta il Servizio Clienti.
Tutte le immagini(1)

Scegli un formato

Cambia visualizzazione
20 μG
193,00 €
50 μG
342,00 €

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Per informazioni sulla disponibilità, contatta il Servizio Clienti.

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTTTTCTCAGATCTGGTTTCTAAGAGTTTTGGGGGGCGGGGCTGTCACCACGTGCAGTATCTCAAGATATTCAGGTGGCCAGAAGAGCTTGTCAGCAAGAGGAGGACAGAATTCTCCCAGCGTTAACACAAAATCCATGGGCAGTATGATGGCAGGTCCTCTGTTGCAAACTCAGTTCCAAAGTCACAGGAAGAAAGCAGAAAGTTCAACTTCCAAAGGGTTAGGACTCTCCACTCAATGTCTTAGGTCAGGAGTTGTGTCTAGGCTGGAAGAGCCAAAGAATATTCCATTTTCCTTTCCTTGTGGTTGAAAACCACAGTCAGTGGAGAGATGTTTGGAAACCACAGTCAGTGGAGCCTGGGTGGTACCCAGGCTTTAGCATTATTGGATGTCAATAGCA

N° accesso Ensembl | uomo

ENSG00000162772

N° accesso NCBI

NM_001040619

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ATF3(467) , ATF3(467)

Categorie correlate

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
YDV
QCS
YJU
HRS
ZES

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Liugen Gu et al.
Pathology, research and practice, 214(6), 862-870 (2018-05-03)
Intestinal epithelial cell (IEC) apoptosis plays a vital role in the pathogenesis of Crohn's disease (CD), which is an inflammatory bowel disease (IBD). Activating transcription factor 3 (ATF3) modulates apoptosis under stress via regulating the p53 pathway. However, the expression
Siqi Ma et al.
International journal of molecular medicine, 35(6), 1561-1573 (2015-04-16)
Glioblastomas are highly malignant gliomas that are extremely invasive with high rates of recurrence and mortality. It has been reported that activating transcription factor 3 (ATF3) is expressed in elevated levels in multiple malignant tumors. The purpose of this study
Xiaolin Liu et al.
Frontiers in physiology, 11, 540591-540591 (2021-02-05)
Mechanical stretch promotes deregulation of vascular smooth muscle cell (VSMC) functions during hypertension-induced vascular remodeling. ACE2 has a wide range of cardiovascular and renal protective effects. Loss of ACE2 is associated with cardiovascular disease, but little is known about the
Genaro Hernandez et al.
Science translational medicine, 12(525) (2020-01-10)
The exocrine pancreas expresses the highest concentrations of fibroblast growth factor 21 (FGF21) in the body, where it maintains acinar cell proteostasis. Here, we showed in both mice and humans that acute and chronic pancreatitis is associated with a loss
Chaojie Hu et al.
Journal of leukocyte biology, 101(3), 633-642 (2016-06-05)
Binge drinking represses host innate immunity and leads to a high risk of infection. Acute EtOH-pretreated macrophages exhibit a decreased production of proinflammatory mediators in response to LPS. ATF3 is induced and counter-regulates the LPS/TLR4 inflammatory cascade. Here, we investigated
Visualizza tutti i documenti correlati

Domande

Recensioni

Nessuna valutazione

Filtri attivi

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.