Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU081441

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK14

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Per informazioni sulla disponibilità, contatta il Servizio Clienti.
Tutte le immagini(1)

Scegli un formato

Cambia visualizzazione
20 μG
193,00 €
50 μG
342,00 €

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Per informazioni sulla disponibilità, contatta il Servizio Clienti.

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TATTTGGGCCAAGGTGTTTCCATTTCTCAATCAGTGCAGTGATACATGTACTCCAGAGGGACAGGGTGGACCCCCTGAGTCAACTGGAGCAAGAAGGAAGGAGGCAGACTGATGGCGATTCCCTCTCACCCGGGACTCTCCCCCTTTCAAGGAAAGTGAACCTTTAAAGTAAAGGCCTCATCTCCTTTATTGCAGTTCAAATCCTCACCATCCACAGCAAGATGAATTTTATCAGCCATGTTTGGTTGTAAATGCTCGTGTGATTTCCTACAGAAATACTGCTCTGAATATTTTGTAATAAAGGTCTTTGCACATGTGACCACATACGTGTTAGGAGGCTGCATGCTCTGGAAGCCTGGACTCTAAGCTGGAGCTCTTGGAAGAGCTCTTCGGTTTCTGAGCAT

N° accesso Ensembl | uomo

ENSG00000112062

N° accesso NCBI

NM_139012

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... MAPK14(1432) , MAPK14(1432)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
QDV
JUU
HQU
XUT
CQT

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Wan-Juan Song et al.
Pathology, research and practice, 213(10), 1282-1288 (2017-09-17)
This study was to identify the biomarkers for the malignancy and poor prognosis in patients with ovarian cancer. The protein expression of p38MAPK family isoform p38α (p38α) and activating transcription factor 2 (ATF2) was measured in 120 ovarian serous adenocarcinomas
Zhe Zhang et al.
Virology, 508, 150-158 (2017-05-26)
Enterovirus71 (EV71) is the major causative agent of hand, foot and mouth disease, which threatens the health of infants and young children. The expression of inflammatory cytokines induced by this viral infection aggravate the illness. Here, we describe the anti-EV71
Y Kim et al.
The British journal of dermatology, 179(3), 689-701 (2018-02-28)
Adiponectin is an adipocyte-derived cytokine that circulates as a full-length protein and a fragment containing the globular domain of adiponectin (gAd). A recent study has reported the antimelanogenic effects of full-length adiponectin. To examine the involvement of gAd in melanogenesis
Yu Wang et al.
Oncology reports, 39(1), 61-70 (2017-11-09)
Photodynamic therapy (PDT) is considered to be an advancing antitumor technology. PDT using hydrophilic/lipophilic tetra‑α-(4-carboxyphenoxy) phthalocyanine zinc (TαPcZn-PDT) has exhibited antitumor activity in Bel-7402 hepatocellular cancer cells. However, the manner in which p38 MAPK and caspase-9 are involved in the regulation
Soha Jawhari et al.
Carcinogenesis, 38(6), 592-603 (2017-04-13)
Glioblastoma multiform (GBM), the most common and aggressive primary brain tumor, is characterized by a high degree of hypoxia and resistance to therapy because of its adaptation capacities, including autophagy and growth factors signaling. In this study, we show an
Visualizza tutti i documenti correlati

Domande

Recensioni

Nessuna valutazione

Filtri attivi

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.