Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU079921

Sigma-Aldrich

MISSION® esiRNA

targeting human MCL1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Per informazioni sulla disponibilità, contatta il Servizio Clienti.
Tutte le immagini(1)

Scegli un formato

Cambia visualizzazione
20 μG
193,00 €
50 μG
342,00 €

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Per informazioni sulla disponibilità, contatta il Servizio Clienti.

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTGCTCCCCATTGATTGAAGAGTCACTGTCTGAAAGAAGCAAAGTTCAGTTTCAGCAACAAACAAACTTTGTTTGGGAAGCTATGGAGGAGGACTTTTAGATTTAGTGAAGATGGTAGGGTGGAAAGACTTAATTTCCTTGTTGAGAACAGGAAAGTGGCCAGTAGCCAGGCAAGTCATAGAATTGATTACCCGCCGAATTCATTAATTTACTGTAGTGTTAAGAGAAGCACTAAGAATGCCAGTGACCTGTGTAAAAGTTACAAGTAATAGAACTATGACTGTAAGCCTCAGTACTGTACAAGGGAAGCTTTTCCTCTCTCTAATTAGCTTTCCCAGTATACTTCTTAGAAAGTCCAAGTGTTCAGGACTTTTATACCTGTTATACTTTGGCTTGGTTTCCATG

N° accesso Ensembl | uomo

ENSG00000143384

N° accesso NCBI

NM_021960

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... MCL1(4170) , MCL1(4170)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
OFU
IYT
UUT
MBT
HQS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Eimear O' Reilly et al.
Scientific reports, 8(1), 15752-15752 (2018-10-27)
Acute myeloid leukaemia (AML) is an aggressive cancer with 50-75% of patients relapsing even after successful chemotherapy. The role of the bone marrow microenvironment (BMM) in protecting AML cells from chemotherapeutics and causing consequent relapse is increasingly recognised. However the
Yuto Yasuda et al.
Cell death & disease, 11(3), 177-177 (2020-03-11)
There have been few advances in the treatment of small-cell lung cancer (SCLC) because of the lack of targets. MCL1, a member of the anti-apoptotic BCL-2 family, may be a treatment target in several cancers, including SCLC. However, whether the
Yuzu Zhao et al.
Cell death & disease, 8(10), e3133-e3133 (2017-10-27)
Demethylzeylasteral is one of the extracts of Tripterygium wilfordii Hook F, which plays important roles in multiple biological processes such as inflammation inhibition, as well as immunosuppression. However, anti-cancer function and the underlying mechanisms of demethylzeylasteral in melanoma cells remain
Takahito Sugase et al.
Cancer research, 77(24), 6975-6986 (2017-10-19)
STAT3 has been implicated recently in radioresistance in cancer. In this study, we investigated the association between STAT3 and radioresistance in esophageal squamous cell carcinoma (ESCC). Strong expression of activated phospho-STAT3 (p-STAT3) was observed in 16/22 ESCC patients with preoperative
Weiguo Zhang et al.
Molecular cancer therapeutics, 13(7), 1848-1859 (2014-04-18)
Aberrant activation of multiple signaling pathways is common in acute myelogenous leukemia (AML) cells, which can be linked to a poor prognosis for patients with this disease. Previous research with mTOR or MEK inhibitors revealed cytostatic, rather than cytotoxic, effects
Visualizza tutti i documenti correlati

Domande

Recensioni

Nessuna valutazione

Filtri attivi

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.