Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU057281

Sigma-Aldrich

MISSION® esiRNA

targeting human E2F3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CACCCTGGACCTCAAACTGTTAACCGAGGATTCAGAGAATCAAAGGTTAGCTTATGTTACATATCAAGATATTCGAAAAATTAGTGGCCTTAAAGACCAAACTGTTATAGTTGTGAAAGCCCCTCCAGAAACAAGACTTGAAGTGCCTGACTCAATAGAGAGCCTACAAATACATTTGGCAAGTACCCAAGGGCCCATTGAGGTTTACTTATGTCCAGAAGAGACTGAAACACACAGTCCAATGAAAACAAACAACCAAGACCACAATGGGAATATCCCTAAACCCGCTTCCAAAGACTTGGCTTCAACCAACTCAGGACATAGCGATTGCTCAGTTTCTATGGGAAACCTTTCTCCTCTGGCCTCCCCAGCCAACCTCTTACAGCAGACTGAGGACCAAATTCCTTCCAACCTAGAAGGACCGTTTGTGAACTTACTGCCTCCCC

N° accesso Ensembl | uomo

ENSG00000112242

N° accesso NCBI

NM_001949

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... E2F3(1871) , E2F3(1871)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Satoko Nakashima et al.
European journal of dermatology : EJD, 27(5), 464-471 (2017-07-26)
Although angiosarcoma exhibits aggressive progression and is associated with unfavourable prognosis, its pathogenesis is poorly understood. In the present study, we investigated the possibility that microRNAs play a role in the pathogenesis of angiosarcoma. microRNA expression was evaluated by array
Junsheng Guo et al.
International journal of clinical and experimental pathology, 13(3), 587-596 (2020-04-10)
Bladder cancer is a common, serious disease worldwide. MicroRNAs (miRNAs) have been reported to participate in the development and progression in many cancers, including bladder cancer. However, the exact roles of miR-22 in bladder cancer process and its underlying mechanism
Zhicai Feng et al.
OncoTargets and therapy, 11, 5303-5313 (2018-09-15)
Melanoma is a malignant tumor that seriously affects patients. The pathogenesis of malignant melanoma is complex, and the cell cycle is closely related to tumor progression. Based on the catalog of cancer somatic mutations, we found that overexpression of the
Sivakumar Vadivel Gnanasundram et al.
Nature communications, 8(1), 2103-2103 (2017-12-14)
The c-myc oncogene stimulates ribosomal biogenesis and protein synthesis to promote cellular growth. However, the pathway by which cells sense and restore dysfunctional mRNA translation and how this is linked to cell proliferation and growth is not known. We here
Dianzhong Geng et al.
International journal of gynecological cancer : official journal of the International Gynecological Cancer Society, 25(4), 707-713 (2015-02-13)
Previous studies confirmed that high-risk human papillomavirus (HR-HPV) infection is a risk factor of cervical cancer, and the infection was associated with significantly reduced miR-34a expression during carcinogenesis. However, the downstream targets of miR-34a and their roles are still not
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.