Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU042361

Sigma-Aldrich

MISSION® esiRNA

targeting human STC1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTCAGGGAAAAGCATTCGTCAAAGAGAGCTTAAAATGCATCGCCAACGGGGTCACCTCCAAGGTCTTCCTCGCCATTCGGAGGTGCTCCACTTTCCAAAGGATGATTGCTGAGGTGCAGGAAGAGTGCTACAGCAAGCTGAATGTGTGCAGCATCGCCAAGCGGAACCCTGAAGCCATCACTGAGGTCGTCCAGCTGCCCAATCACTTCTCCAACAGATACTATAACAGACTTGTCCGAAGCCTGCTGGAATGTGATGAAGACACAGTCAGCACAATCAGAGACAGCCTGATGGAGAAAATTGGGCCTAACATGGCCAGCCTCTTCCACATCCTGCAGACAGACCACTGTGCCCAAACACACCCACGAGCTGACTTCAACAGGAGACGCACCAATGAGCCGCAGAAGCTGAAAGTCCTCCTCAGGAACCTCCGAGGTGAGGAGGACTCTCCCTCCCACATCAA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Dong Dai et al.
Oncology reports, 35(1), 552-558 (2015-11-05)
The new anti-aging gene Klotho has been identified as a multi-functional humoral factor which influences multiple biological processes, including tumor progression. Although ample evidence indicates that Klotho plays important roles in cervical, lung and breast cancer, the role and mechanism
Fei Zhao et al.
Oxidative medicine and cellular longevity, 2020, 1898213-1898213 (2020-04-23)
Contrast-induced acute kidney injury (CI-AKI) is the third common cause of acute kidney injury (AKI), which is associated with poor short- and long-term outcomes. Currently, effective therapy strategy for CI-AKI remains lacking. Stanniocalcin-1 (STC1) is a conserved glycoprotein with antiapoptosis
Wenru Su et al.
Journal of molecular cell biology, 9(4), 289-301 (2017-06-29)
Mesenchymal stem cells (MSCs) have been demonstrated to have promising therapeutic benefits for a variety of neurological diseases; however, the underlying mechanisms are poorly understood. Here, we showed that intravitreal infusion of MSCs promoted retinal ganglion cell (RGC) survival in
Yin-Bo Niu et al.
Acta pharmacologica Sinica, 41(11), 1476-1486 (2020-09-17)
Recent studies demonstrate that diet quercetin (Quer) has obvious bone protective effects on ovariectomized rodents but thus far there is no direct evidence to support the inhibitory effect of Quer on bone loss caused by long-term unloading. In the present
Huai-Bin Hu et al.
Nature communications, 12(1), 662-662 (2021-01-30)
Dynamic assembly and disassembly of primary cilia controls embryonic development and tissue homeostasis. Dysregulation of ciliogenesis causes human developmental diseases termed ciliopathies. Cell-intrinsic regulatory mechanisms of cilia disassembly have been well-studied. The extracellular cues controlling cilia disassembly remain elusive, however.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.