Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU033071

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK6

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGTTTCAGCTTCTCCGAGGTCTGGACTTTCTTCATTCACACCGAGTAGTGCATCGCGATCTAAAACCACAGAACATTCTGGTGACCAGCAGCGGACAAATAAAACTCGCTGACTTCGGCCTTGCCCGCATCTATAGTTTCCAGATGGCTCTAACCTCAGTGGTCGTCACGCTGTGGTACAGAGCACCCGAAGTCTTGCTCCAGTCCAGCTACGCCACCCCCGTGGATCTCTGGAGTGTTGGCTGCATATTTGCAGAAATGTTTCGTAGAAAGCCTCTTTTTCGTGGAAGTTCAGATGTTGATCAACTAGGAAAAATCTTGGACGTGATTGGACTCCCAGGAGAAGAAGACTGGCCTAGAGATGTTGCCCTTCCCAGGCAGGCTTTTCATTCAAAATCTGCCCAACCAATTGAG

N° accesso Ensembl | uomo

ENSG00000105810

N° accesso NCBI

NM_001259

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CDK6(1021) , CDK6(1021)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Míriam Tarrado-Castellarnau et al.
Molecular systems biology, 13(10), 940-940 (2017-10-06)
Cyclin-dependent kinases (CDK) are rational cancer therapeutic targets fraught with the development of acquired resistance by tumor cells. Through metabolic and transcriptomic analyses, we show that the inhibition of CDK4/6 leads to a metabolic reprogramming associated with gene networks orchestrated
Tao Gong et al.
Aging, 12(12), 12086-12106 (2020-06-26)
Emerging studies indicate that long non-coding RNAs (lncRNAs) play crucial roles in colorectal cancer (CRC). Here, we reported lncRNA CASC21, which is induced by FOXP1, functions as an oncogene in CRC. We systematically elucidated its clinical significance and possible molecular
Lihua Guo et al.
Journal of B.U.ON. : official journal of the Balkan Union of Oncology, 23(3), 787-794 (2018-07-14)
Clear cell renal cell carcinoma (ccRCC) accounts for 70-80% of renal cell carcinomas. Various microRNAs (miRs) have been reported to affect the tumorigenesis of ccRCC. However, the role of miR-384 in ccRCC is still unknown. Thus, the purpose of this
Xuefeng Pan et al.
Molecular therapy. Nucleic acids, 22, 38-49 (2020-09-11)
Emerging studies indicate that long noncoding RNAs (lncRNAs) play crucial roles in ovarian cancer (OC). By analyzing high-throughput data, we found that SNHG17 was highly expressed in multiple OC cohorts. However, its functions in OC were not explored. In this
Tongzheng Liu et al.
Nature communications, 8, 13923-13923 (2017-01-10)
Tumour metastasis, the spread of cancer cells from the original tumour site followed by growth of secondary tumours at distant organs, is the primary cause of cancer-related deaths and remains poorly understood. Here we demonstrate that inhibition of CDK4/6 blocks
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.