Přejít k obsahu
Merck
Všechny fotografie(1)

Key Documents

EHU119551

Sigma-Aldrich

MISSION® esiRNA

targeting human SOCS3

Přihlásitk zobrazení cen stanovených pro organizaci a smluvních cen
Všechny fotografie(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTCAGCTCCAAGAGCGAGTACCAGCTGGTGGTGAACGCAGTGCGCAAGCTGCAGGAGAGCGGCTTCTACTGGAGCGCAGTGACCGGCGGCGAGGCGAACCTGCTGCTCAGTGCCGAGCCCGCCGGCACCTTTCTGATCCGCGACAGCTCGGACCAGCGCCACTTCTTCACGCTCAGCGTCAAGACCCAGTCTGGGACCAAGAACCTGCGCATCCAGTGTGAGGGGGGCAGCTTCTCTCTGCAGAGCGATCCCCGGAGCACGCAGCCCGTGCCCCGCTTCGACTGCGTGCTCAAGCTGGTGCACCACTACATGCCGCCCCCTGGAGCCCCCTCCTTCCCCTCGCCACCTACTGAACCCTCCTCCGAGGTGCCCGAGCAGCCGTCTGCCCAGCCACTCCCTGGGAGTCCCCCCAGAAGAGCCTATTACATCTACTCCGGGGGCGAGAAGATCCCCCTGGTGTTGAGCCGGCCCCTCTCCTCCAACGTGGCCACTCTTCAGCATCTCTGTCGGAAGACCGT

Ensembl | human accession no.

ENSG00000184557

NCBI accession no.

NM_003955

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SOCS3(9021) , SOCS3(9021)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Osvědčení o analýze (COA)

Vyhledejte osvědčení Osvědčení o analýze (COA) zadáním čísla šarže/dávky těchto produktů. Čísla šarže a dávky lze nalézt na štítku produktu za slovy „Lot“ nebo „Batch“.

Již tento produkt vlastníte?

Dokumenty související s produkty, které jste v minulosti zakoupili, byly za účelem usnadnění shromážděny ve vaší Knihovně dokumentů.

Navštívit knihovnu dokumentů

Rak-Kyun Seong et al.
Pathogens (Basel, Switzerland), 9(3) (2020-03-04)
Zika virus (ZIKV) is a mosquito-borne flavivirus that has emerged and caused global outbreaks since 2007. Although ZIKV proteins have been shown to suppress early anti-viral innate immune responses, little is known about the exact mechanisms. This study demonstrates that
Yan Zhang et al.
Journal of neuroinflammation, 14(1), 211-211 (2017-11-04)
Morphine tolerance is a clinical challenge, and its pathogenesis is closely related to the neuroinflammation mediated by Toll-like receptor 4 (TLR4). In Chinese pain clinic, lidocaine is combined with morphine to treat chronic pain. We found that lidocaine sufficiently inhibited
Ranu Surolia et al.
American journal of physiology. Lung cellular and molecular physiology, 311(5), L928-L940 (2016-11-04)
Pulmonary infections with nontuberculous mycobacteria (P-NTM), such as by Mycobacterium avium complex (M. avium), are increasingly found in the elderly, but the underlying mechanisms are unclear. Recent studies suggest that adaptive immunity is necessary, but not sufficient, for host defense
Shusheng Che et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(9), 6805-6811 (2015-04-05)
Malignant glioma is the most common intracranial tumor with poor prognosis. It is well believed that glioma stem cells (GSCs) are responsible for the initiation and progression of glioma. Janus kinase/signal transducer and activator of transcription (Jak/STAT3) pathway plays a
Naotoshi Iwahara et al.
Journal of Alzheimer's disease : JAD, 55(3), 1235-1247 (2016-11-05)
In response to changes of the central nervous system environment, microglia are capable of acquiring diverse phenotypes for cytotoxic or immune regulation and resolution of injury. Alzheimer's disease (AD) pathology also induces several microglial activations, resulting in production of pro-inflammatory
Zobrazit všechny související dokumenty

Náš tým vědeckých pracovníků má zkušenosti ve všech oblastech výzkumu, včetně přírodních věd, materiálových věd, chemické syntézy, chromatografie, analytiky a mnoha dalších..

Obraťte se na technický servis.