Přejít k obsahu
Merck
Všechny fotografie(1)

Key Documents

EHU108281

Sigma-Aldrich

MISSION® esiRNA

targeting human MCTS1

Přihlásitk zobrazení cen stanovených pro organizaci a smluvních cen


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTCCGATGCCATGAACATATAGAAATCCTTACAGTAAATGGAGAATTACTCTTTTTTAGACAAAGAGAAGGGCCTTTTTATCCAACCCTAAGATTACTTCACAAATATCCTTTTATCCTGCCACACCAGCAGGTTGATAAAGGAGCCATCAAATTTGTACTCAGTGGAGCAAATATCATGTGTCCAGGCTTAACTTCTCCTGGAGCTAAGCTTTACCCTGCTGCAGTAGATACCATTGTTGCTATCATGGCAGAAGGAAAACAGCATGCTCTATGTGTTGGAGTCATGAAGATGTCTGCAGAAGACATTGAGAAAGTCAACAAAGGAATTGGCATTGAAAATATCCATTATTTAAATGATGGGCTGTGGCATATGAAGACATATAAATGAGCCTCAGAAGGAATGCACTTGGGCTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Osvědčení o analýze (COA)

Vyhledejte osvědčení Osvědčení o analýze (COA) zadáním čísla šarže/dávky těchto produktů. Čísla šarže a dávky lze nalézt na štítku produktu za slovy „Lot“ nebo „Batch“.

Již tento produkt vlastníte?

Dokumenty související s produkty, které jste v minulosti zakoupili, byly za účelem usnadnění shromážděny ve vaší Knihovně dokumentů.

Navštívit knihovnu dokumentů

C J De Saedeleer et al.
Oncogene, 33(31), 4060-4068 (2013-10-30)
The glycolytic end-product lactate is a pleiotropic tumor growth-promoting factor. Its activities primarily depend on its uptake, a process facilitated by the lactate-proton symporter monocarboxylate transporter 1 (MCT1). Therefore, targeting the transporter or its chaperon protein CD147/basigin, itself involved in
Cassidy C Daw et al.
Cell, 183(2), 474-489 (2020-10-10)
Mg2+ is the most abundant divalent cation in metazoans and an essential cofactor for ATP, nucleic acids, and countless metabolic enzymes. To understand how the spatio-temporal dynamics of intracellular Mg2+ (iMg2+) are integrated into cellular signaling, we implemented a comprehensive
Chunxiao Yan et al.
International journal of clinical and experimental pathology, 8(3), 2710-2718 (2015-06-06)
This study was designed to investigate the role of MCT1 in the development of cisplatin-resistant ovarian cancer and its possible relationship with Fas. We found the expression of MCT1 was obviously increased both in cisplatin-resistant ovarian cancer tissue and A2780/CP

Náš tým vědeckých pracovníků má zkušenosti ve všech oblastech výzkumu, včetně přírodních věd, materiálových věd, chemické syntézy, chromatografie, analytiky a mnoha dalších..

Obraťte se na technický servis.