Přejít k obsahu
Merck
Všechny fotografie(1)

Hlavní dokumenty

EHU031451

Sigma-Aldrich

MISSION® esiRNA

targeting human BRCA2

Přihlásitk zobrazení cen stanovených pro organizaci a smluvních cen


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGCTGCAACAAAGCAGATTTAGGACCAATAAGTCTTAATTGGTTTGAAGAACTTTCTTCAGAAGCTCCACCCTATAATTCTGAACCTGCAGAAGAATCTGAACATAAAAACAACAATTACGAACCAAACCTATTTAAAACTCCACAAAGGAAACCATCTTATAATCAGCTGGCTTCAACTCCAATAATATTCAAAGAGCAAGGGCTGACTCTGCCGCTGTACCAATCTCCTGTAAAAGAATTAGATAAATTCAAATTAGACTTAGGAAGGAATGTTCCCAATAGTAGACATAAAAGTCTTCGCACAGTGAAAACTAAAATGGATCAAGCAGATGATGTTTCCTGTCCACTTCTAAATTCTTGTCTTAGTGAAAGTCCTGTTGTTCTACAATGTACACATGTAACACCACAAAGAGATAAGTCAGTGGTATGTGGGAGTTTGTTTCATACACCAAAGTTTGTGAAGGGTCGTCAGACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Vyberte jednu z posledních verzí:

Osvědčení o analýze (COA)

Lot/Batch Number

Nevidíte správnou verzi?

Potřebujete-li konkrétní verzi, můžete vyhledat daný certifikát podle čísla dávky nebo čísla šarže.

Již tento produkt vlastníte?

Dokumenty související s produkty, které jste v minulosti zakoupili, byly za účelem usnadnění shromážděny ve vaší Knihovně dokumentů.

Navštívit knihovnu dokumentů

Sukrit Mahajan et al.
The international journal of biochemistry & cell biology, 107, 128-139 (2018-12-28)
Cancer cells exhibit HR defects, increased proliferation and checkpoint aberrations. Tumour suppressor proteins, BRCA2 and p53 counteract such aberrant proliferation by checkpoint regulation. Intriguingly, chemo-resistant cancer cells, exhibiting mutated BRCA2 and p53 protein survive even with increased DNA damage accumulation.
Zdenek Skrott et al.
Oncogene, 38(40), 6711-6722 (2019-08-09)
Aldehyde dehydrogenase (ALDH) is a proposed biomarker and possible target to eradicate cancer stem cells. ALDH inhibition as a treatment approach is supported by anti-cancer effects of the alcohol-abuse drug disulfiram (DSF, Antabuse). Given that metabolic products of DSF, rather
Dusana Majera et al.
Cells, 9(2) (2020-02-23)
Research on repurposing the old alcohol-aversion drug disulfiram (DSF) for cancer treatment has identified inhibition of NPL4, an adaptor of the p97/VCP segregase essential for turnover of proteins involved in multiple pathways, as an unsuspected cancer cell vulnerability. While we
Weixing Zhao et al.
Nature, 550(7676), 360-365 (2017-10-05)
The tumour suppressor complex BRCA1-BARD1 functions in the repair of DNA double-stranded breaks by homologous recombination. During this process, BRCA1-BARD1 facilitates the nucleolytic resection of DNA ends to generate a single-stranded template for the recruitment of another tumour suppressor complex
Joshua R Heyza et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(8), 2523-2536 (2018-12-13)
ERCC1/XPF is a DNA endonuclease with variable expression in primary tumor specimens, and has been investigated as a predictive biomarker for efficacy of platinum-based chemotherapy. The failure of clinical trials utilizing ERCC1 expression to predict response to platinum-based chemotherapy suggests

Náš tým vědeckých pracovníků má zkušenosti ve všech oblastech výzkumu, včetně přírodních věd, materiálových věd, chemické syntézy, chromatografie, analytiky a mnoha dalších..

Obraťte se na technický servis.