Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU110531

Sigma-Aldrich

MISSION® esiRNA

targeting human PPIB

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGTAGGCCGGGTGATCTTTGGTCTCTTCGGAAAGACTGTTCCAAAAACAGTGGATAATTTTGTGGCCTTAGCTACAGGAGAGAAAGGATTTGGCTACAAAAACAGCAAATTCCATCGTGTAATCAAGGACTTCATGATCCAGGGCGGAGACTTCACCAGGGGAGATGGCACAGGAGGAAAGAGCATCTACGGTGAGCGCTTCCCCGATGAGAACTTCAAACTGAAGCACTACGGGCCTGGCTGGGTGAGCATGGCCAACGCAGGCAAAGACACCAACGGCTCCCAGTTCTTCATCACGACAGTCAAGACAGCCTGGCTAGATGGCAAGCATGTGGTGTTTGGCAAAGTTCTAGAGGGCATGGAGGTGGTGCGGAAGGTGGAGAGCACCAAGACAGACAGCCGGGATAAACCCCTGAAGGATGTGATCATCGCAGACTGCGGCAAGATCGAGGTGGAGAAG

Ensembl | human accession no.

ENSG00000166794

NCBI accession no.

NM_000942

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PPIB(5479) , PPIB(5479)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Li Liu et al.
Retrovirology, 8, 94-94 (2011-11-16)
Upon cellular entry retroviruses must avoid innate restriction factors produced by the host cell. For human immunodeficiency virus (HIV) human restriction factors, APOBEC3 (apolipoprotein-B-mRNA-editing-enzyme), p21 and tetherin are well characterised. To identify intrinsic resistance factors to HIV-1 replication we screened
Paulo C M Urbano et al.
Frontiers in immunology, 10, 3047-3047 (2020-02-11)
Maintenance of regulatory T cells CD4+CD25highFOXP3+ (Treg) stability is vital for proper Treg function and controlling the immune equilibrium. Treg cells are heterogeneous and can reveal plasticity, exemplified by their potential to express IL-17A. TNFα-TNFR2 signaling controls IL-17A expression in
Roberto A Avelar et al.
Genome biology, 21(1), 91-91 (2020-04-09)
Cellular senescence, a permanent state of replicative arrest in otherwise proliferating cells, is a hallmark of aging and has been linked to aging-related diseases. Many genes play a role in cellular senescence, yet a comprehensive understanding of its pathways is
J E Hanning et al.
British journal of cancer, 108(2), 450-460 (2013-01-10)
When designing therapeutic short-interfering RNAs (siRNAs), off-target effects (OTEs) are usually predicted by computational quantification of messenger RNAs (mRNAs) that contain matches to the siRNA seed sequence in their 3' UTRs. It is assumed that the higher the number of
Ana O'Loghlen et al.
Cell stem cell, 10(1), 33-46 (2012-01-10)
The Polycomb Group (PcG) of chromatin modifiers regulates pluripotency and differentiation. Mammalian genomes encode multiple homologs of the Polycomb repressive complex 1 (PRC1) components, including five orthologs of the Drosophila Polycomb protein (Cbx2, Cbx4, Cbx6, Cbx7, and Cbx8). We have
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico