Direkt zum Inhalt
Merck

PP0410

Sigma-Aldrich

PhosphoProfile I Phosphopeptide Enrichment Kit

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
12352200

Preise und Verfügbarkeit sind derzeit nicht verfügbar.

Verwendung

sufficient for 24 purifications

Versandbedingung

wet ice

Lagertemp.

2-8°C

Ähnliche Artikel vergleichen

Vollständigen Vergleich anzeigen

Unterschiede anzeigen

1 of 4

Dieser Artikel
EHU903961EMU147591EHU031881
esiRNA cDNA target sequence

CACGAACCCCAGACCTGTTTGTATCATCCGGGCTCCTTCCGGGCAGAAACAACTGAAAATGCACTTCAGACCCACTTATTTCTGCCACATCTGAGTCGGCCTGAGATAGACTTTTCCCTCTAAACTGGGAGAATATCACAGTGGTTTTTGTTAGCAGAAAATGCACTCCAGCCTCTGTACTCATCTAAGCTGCTTATTTTTGATATTTGTGTCAGTCTGTAAATGGATACTTCACTTTAATAACTGTTGCTTAGTAATTGGCTTTGTAGAGAAGCTGGAAAAAAATGGTTTTGTCTTCAACTCCTTTGCATGCCAGG

esiRNA cDNA target sequence

GCGTGCGCACCTTCCTGTCCTAGGCCAGGTGCCATGGCCGGCCAGGTGGGCTGCAGAGTGGGCTCCCTGCCCCTCTCTGCCTGTTCTGGACTGTGTTCTGGGCCTGCTGAGGATGGCAGAGCTGGTGTCCATCCAGCACTGACCAGCCCTGATTCCCCGACCACCGCCCAGGGTGGAGAAGGAGGCCCTTGCTTGGCGTGGGGGATGGCTTAACTGTACCTGTTTGGATGCTTCTGAATAGAAATAAAGTGGGTTTTCCCTGGAGGT

esiRNA cDNA target sequence

GAAGGCTGCGGATCAACAATCAGGCGCCTCTGCTTCCAGGGCGCCGGGGGCCTGACTCGGTGGTGAGTGCGGCTGCCTTCGTCAGGACGGGCGAGCGTGGCTCTCGACGGCTGGGCGGGCTAGCTGACTCCTCCTTCGGCCCGGAAGGCAGTTCTCAGGGCCGCCCGACCCCCGCTCCCTGCCTAAGTCCTTGGGCTTGGACTTGTATAACAGTTTTGCTTTCTTTTCCTTTCGGTTTATTTTTTCAGTCAACCCAGGCTAGTCTCGAATTTGCGGCAATCCTCCTGCCTCCAATCGTTCTAGGTGCTGGGATTACTGGTGTGCAGCACCTCGGCTGTCTCTTCAGATTTTCTGCAGGTT

esiRNA cDNA target sequence

TGGGAGTGACAGATGATGGAGAAGGAAGTCATATTCTTCAATCTCCATCAGCCAATGTGCTTCCAACCCTTCCTTTCCACGTCCTTCGTAGCTTGTTTAGCACTACACCTTTGACAACTGATGATGGTGTACTTCTAAGGCGGATGGCATTGGAAATTGGAGCCTTACACCTCATTCTTGTCTGTCTCTCTGCTTTGAGCCACCATTCCCCACGAGTTCCAAACTCTAGCGTGAATCAAACTGAGCCACAGGTGTCAAGCTCTCATAACCCTACATCAACAGAAGAACAACAGTTATATTGGGCCAAAGGGACTGGCTTTGGAACAGGCTCTACAGCTTCTGGGTGGGATGTGGAACAAGCCTTAACTAAGCAAAGGCTGGAAGAGGAACATGTTACCTGCCTTCTGCAGGTT

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

form

lyophilized, lyophilized powder

form

lyophilized, lyophilized powder

form

lyophilized powder

form

lyophilized powder

shipped in

ambient

shipped in

ambient

shipped in

ambient

shipped in

ambient

Anwendung

The PhosphoProfile I Phosphopeptide Enrichment Kit is designed to increase the concentration of phosphopeptides from tryptic digests by immobilized metal affinity chromatography (IMAC). The enriched solution helps to overcome the limitations of mass spectrometry of phosphopeptides. The provided reagents are compatible with downstream LC-MS and MALDI-TOF MS analysis.

Leistungsmerkmale und Vorteile

  • Low non-specific binding - high data confidence
  • No bias in phosphorylation states - accurate representation of phosphorylation types present for sample comparisons
  • Fast sample processing - reduces time to data generation from sample collection
  • Complete optimized set of reagents and enzymes - Reduce cost and effort with total sample management in one package

Sonstige Hinweise

The kit is a convenient collection of all materials necessary to perform phosphopeptide enrichments from crude samples following tryptic digestion. The supplied phosphopeptide capture matrix is a novel Ga (III) chelate silica based on Sigma-Aldrich′s proprietary nitriloacetic acid (NTA) analog. The matrix is packed into spin columns for easy, microscale affinity capture of phosphopeptides.

Rechtliche Hinweise

PhosphoProfile is a trademark of Sigma-Aldrich Co. LLC

Kit-Komponenten auch einzeln erhältlich

Produkt-Nr.
Beschreibung
SDB

  • T6567Trypsin from porcine pancreas, Proteomics Grade, BioReagent, DimethylatedSDB

  • Trypsin Solubilization Reagent


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Maria V Turkina et al.
Methods in molecular biology (Clifton, N.J.), 355, 305-316 (2006-11-10)
Reversible protein phosphorylation is crucially involved in all aspects of plant cell physiology. The highly challenging task of revealing and characterizing the dynamic protein phosphorylation networks in plants has only recently begun to become feasible, owing to application of dedicated
Thomas Nühse et al.
Current protocols in molecular biology, Chapter 18, Unit 18-Unit 18 (2008-02-12)
The identification of protein phosphorylation sites from cell-derived proteins is crucial to the understanding of signal transduction pathways. While determining the modified sites on individual proteins can present a significant challenge, recent progress in the rapid, large-scale identification of phosphopeptides
Yeong Hee Ahn et al.
Rapid communications in mass spectrometry : RCM, 18(20), 2495-2501 (2004-09-24)
The enrichment of phosphopeptides using immobilized metal ion affinity chromatography (IMAC) and subsequent mass spectrometric analysis is a powerful protocol for detecting phosphopeptides and analyzing their phosphorylation state. However, nonspecific binding peptides, such as acidic, nonphosphorylated peptides, often coelute and

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.