HSTUD1491
MISSION® Synthetic microRNA Inhibitor, Human
hsa-miR-4484
Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)
About This Item
Produktlinie
MISSION®
Form
solid
Ausgereifte Sequenz
AAAAGGCGGGAGAAGCCCCA
Sanger-Hinterlegungsnummer ausgereifte/nicht ausgereifte Sequenzen
Sanger microRNA-Hinterlegungsnummer
Lagertemp.
−20°C
Allgemeine Beschreibung
Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
- Long lasting inhibition at very low dosage
- Excellent resistance to cellular nucleases
- Custom synthesis available for a variety of species
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
Sonstige Hinweise
Based on miRBase V19
Rechtliche Hinweise
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Signalwort
Warning
H-Sätze
P-Sätze
Gefahreneinstufungen
STOT RE 2 Inhalation
Zielorgane
Respiratory Tract
Lagerklassenschlüssel
11 - Combustible Solids
WGK
WGK 3
Flammpunkt (°F)
Not applicable
Flammpunkt (°C)
Not applicable
Analysenzertifikate (COA)
Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.
Besitzen Sie dieses Produkt bereits?
In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.
Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..
Setzen Sie sich mit dem technischen Dienst in Verbindung.