Direkt zum Inhalt
Merck

EMU016141

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Foxm1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGCGTTAAGCAGGAACTGGAAGAGAAGGAGAATTGTCACCTGGAGCAGAATCGGGTTAAGGTTGAGGAGCCCTCAGGAGTGTCAACATCTTGGCAGGACTCTGTGTCTGAGAGGCCACCCTACTCTTATATGGCCATGATACAGTTTGCCATCAACAGCACTGAGAGAAAGCGCATGACCTTGAAGGACATCTACACTTGGATTGAGGACCACTTCCCTTACTTTAAGCACATTGCCAAGCCAGGCTGGAAGAACTCTATTCGTCACAACCTTTCTCTCCATGACATGTTTGTTCGAGAGACATCTGCCAATGGCAAGGTCTCCTTCTGGACCATTCACCCAAGTGCCAATCGCTACTTGACATTGGACCAAGTGTTTAAGCCACTGGAACCAGGGTCTCCACAATCGCCCGAGCACTTGGAATCACAGCA

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xiaoxiao Li et al.
Journal of translational medicine, 11, 204-204 (2013-09-06)
Forkhead box transcription factor 1 (FOXM1) has been reported to overexpress and correlate with pathogenesis in a variety of human malignancies. However, little research has been done to investigate its clinical significance in gastric cancer. We examined the expression of
KanKan Yang et al.
Journal of experimental & clinical cancer research : CR, 34, 40-40 (2015-05-04)
The Forkhead box M1 (FOXM1) is an oncogenic transcription factor and plays a significant role in cell EMT, proliferation, metastasis in a multitude of human solid tumors including colorectal cancer (CRC). However, the underlying molecular mechanisms by which FoxM1 contributes
Satoru Inoguchi et al.
FEBS letters, 588(17), 3170-3179 (2014-07-08)
Here, we found that microRNA-24-1 (miR-24-1) is significantly reduced in bladder cancer (BC) tissues, suggesting that it functions as a tumour suppressor. Restoration of mature miR-24-1 inhibits cancer cell proliferation and induces apoptosis. Forkhead box protein M1 (FOXM1) is a
Jiujie Cui et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(10), 2595-2606 (2014-03-19)
The transcription factor Forkhead box protein M1 (FOXM1) plays critical roles in cancer development and progression. However, the regulatory role and underlying mechanisms of FOXM1 in cancer metabolism are unknown. In this study, we characterized the regulation of aerobic glycolysis
Weihua Jiang et al.
International journal of clinical and experimental pathology, 8(6), 6756-6763 (2015-08-12)
The oncogenic transcription factor forkhead box protein M1 (FOXM1) plays critical roles in gastric cancer (GC) development and progression. However, the underlying mechanisms has not fully demonstrated. Lactate dehydrogenase A (LDHA) is widely overexpressed in a series of cancers and

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.