Direkt zum Inhalt
Merck

EHU115141

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPA8

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AACCGAACCACTCCAAGCTATGTCGCCTTTACGGACACTGAACGGTTGATCGGTGATGCCGCAAAGAATCAAGTTGCAATGAACCCCACCAACACAGTTTTTGATGCCAAACGTCTGATTGGACGCAGATTTGATGATGCTGTTGTCCAGTCTGATATGAAACATTGGCCCTTTATGGTGGTGAATGATGCTGGCAGGCCCAAGGTCCAAGTAGAATACAAGGGAGAGACCAAAAGCTTCTATCCAGAGGAGGTGTCTTCTATGGTTCTGACAAAGATGAAGGAAATTGCAGAAGCCTACCTTGGGAAGACTGTTACCAATGCTGTGGTCACAGTGCCAGCTTACTTTAATGACTCTCAGCGTCAGGCTACCAAAGATGCTGGAACTATTGCTGGTCTCAATGTACTTAGAATTATTAATGAGCCAACTGCTGCTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Midori Ikezaki et al.
Biochemical and biophysical research communications, 527(2), 481-488 (2020-04-28)
Heat-shock cognate protein 70 (Hsc70), a molecular chaperone, is involved in multiple cellular functions. We previously demonstrated that Hsc70 is required for TGF-β-induced Smad signaling in mesenchymal-like NRK-49F cells. In the present study, to compare the Hsc70 functions in TGF-β-related
Ximeng Yang et al.
Scientific reports, 8(1), 11707-11707 (2018-08-05)
We previously found diosgenin, an herbal drug-derived steroid sapogenin, to be remarkably effective at restoring Aβ-induced axonal degeneration and improving memory function in model of Alzheimer's disease (AD), 5XFAD mouse. In this study, we investigated the downstream signaling of diosgenin
Guan Sun et al.
Neuromolecular medicine, 21(1), 33-41 (2019-01-05)
Heat shock cognate protein 70 (Hsc70) is a key mediator for the maintenance of intracellular proteins and regulates cellular activities. And it is elevated in various tumor tissues including glioma, which is closely related to the malignancy and poor prognosis
Guan Sun et al.
Journal of cellular biochemistry, 120(6), 10707-10714 (2019-03-01)
Migration and invasion are often recognized as the main reasons for the high recurrence and death rates of glioma and limit the efficacy of surgery and other antitumor therapies. In this study, we found over activation of heat shock cognate
Nerea Allende-Vega et al.
Scientific reports, 9(1), 5637-5637 (2019-04-06)
Eliminating mutant p53 (mt p53) protein could be a useful strategy to treat mt p53 tumors and potentially improve the prognosis of cancer patients. In this study, we unveil different mechanisms that eliminate p53-R248Q, one of the most frequent mutants

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.