Direkt zum Inhalt
Merck

EHU109561

Sigma-Aldrich

MISSION® esiRNA

targeting human PSMD4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GAAGGTGGCAAGATGGTGTTGGAAAGCACTATGGTGTGTGTGGACAACAGTGAGTATATGCGGAATGGAGACTTCTTACCCACCAGGCTGCAGGCCCAGCAGGATGCTGTCAACATAGTTTGTCATTCAAAGACCCGCAGCAACCCTGAGAACAACGTGGGCCTTATCACACTGGCTAATGACTGTGAAGTGCTGACCACACTCACCCCAGACACTGGCCGTATCCTGTCCAAGCTACATACTGTCCAACCCAAGGGCAAGATCACCTTCTGCACGGGCATCCGCGTGGCCCATCTGGCTCTGAAGCACCGACAAGGCAAGAATCACAAGATGCGCATCATTGCCTTTGTGGGAAGCCCAGTGGAGGACAATGAGAAGGATCTGGTGAAACTGGCTAAACGCCTCAAGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

WGK

WGK 1

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Pere Dosta et al.
Cardiovascular engineering and technology, 12(1), 114-125 (2021-01-22)
Endothelial cell (EC) dysfunction underlies the pathology of multiple disease conditions including cardiovascular and pulmonary diseases. Dysfunctional ECs have a distinctive gene expression profile compared to healthy ECs. RNAi therapy is a powerful therapeutic approach that can be used to
Ai-Guo Ma et al.
The Kaohsiung journal of medical sciences, 35(10), 591-597 (2019-06-05)
Proteasome 26S subunit non-ATPase 4 (PSMD4) is an important proteasome ubiquitin receptor and plays a key role in endoplasmic reticulum stress (ERS). However, the study of PSMD4 in esophageal cancer (EC) is relatively rare. Here, we found that the expression
Lei Xu et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(10), 13194-13210 (2020-12-16)
Ablation of miR-144/451 disrupts homeostasis of erythropoiesis. Myc, a protooncogenic protein, is essential for erythroblast proliferation but commits rapid downregulation during erythroid maturation. How erythroblasts orchestrate maturation processes through coding and non-coding genes is largely unknown. In this study, we
Padma Murthi et al.
Cells, 9(4) (2020-04-16)
We reported earlier that an anti-inflammatory small peptide receptor-formyl peptide receptor-2 (FPR2) was significantly decreased in placentas from third trimester pregnancies complicated with fetal growth restriction (FGR), compared to placentas from uncomplicated control pregnancies, suggesting FPR2 may play a role
Emma-Kate Loveday et al.
The Journal of general virology, 96(Pt 1), 30-39 (2014-09-23)
A common critical cellular event that many human enveloped viruses share is the requirement for proteolytic cleavage of the viral glycoprotein by furin in the host secretory pathway. For example, the furin-dependent proteolytic activation of highly pathogenic (HP) influenza A

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.