Direkt zum Inhalt
Merck

EHU097711

Sigma-Aldrich

MISSION® esiRNA

targeting human PPARG

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00


Check Cart for Availability


Größe auswählen

Ansicht ändern
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

CHF 249.00


Check Cart for Availability

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGAATGTGAAGCCCATTGAAGACATTCAAGACAACCTGCTACAAGCCCTGGAGCTCCAGCTGAAGCTGAACCACCCTGAGTCCTCACAGCTGTTTGCCAAGCTGCTCCAGAAAATGACAGACCTCAGACAGATTGTCACGGAACACGTGCAGCTACTGCAGGTGATCAAGAAGACGGAGACAGACATGAGTCTTCACCCGCTCCTGCAGGAGATCTACAAGGACTTGTACTAGCAGAGAGTCCTGAGCCACTGCCAACATTTCCCTTCTTCCA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Pradip K Saha et al.
American journal of physiology. Endocrinology and metabolism, 319(4), E667-E677 (2020-08-18)
MicroRNA-30a (miR-30a) impacts adipocyte function, and its expression in white adipose tissue (WAT) correlates with insulin sensitivity in obesity. Bioinformatic analysis demonstrates that miR-30a expression contributes to 2% of all miRNA expression in human tissues. However, molecular mechanisms of miR-30a
Vahid Kheirollahi et al.
Nature communications, 10(1), 2987-2987 (2019-07-07)
Idiopathic pulmonary fibrosis (IPF) is a fatal disease in which the intricate alveolar network of the lung is progressively replaced by fibrotic scars. Myofibroblasts are the effector cells that excessively deposit extracellular matrix proteins thus compromising lung structure and function.
Wenxin Hu et al.
Environmental science & technology, 51(7), 4061-4068 (2017-03-11)
2-Ethylhexyl diphenyl phosphate (EHDPP), an organophosphate flame retardant (OPFR), is frequently detected in human blood. In this study, the sensitive dual-luciferase reporter gene assay and molecular docking were used to investigate the activation of EHDPP to human peroxisome proliferator-activated receptor
Miao Xu et al.
Oncotarget, 8(56), 95914-95930 (2017-12-10)
The poor prognosis of esophageal squamous cell carcinoma (ESCC) emphasizes the urgent need to better understand the carcinogenesis and develop prevention strategies. Previous studies have highlighted the potential of using Vitamin E (tocopherols) for cancer chemoprevention, but the preventive activity

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.