Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU086621

Sigma-Aldrich

MISSION® esiRNA

targeting human TLR4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAACAAAGGTGGGAATGCTTTTTCAGAAGTTGATCTACCAAGCCTTGAGTTTCTAGATCTCAGTAGAAATGGCTTGAGTTTCAAAGGTTGCTGTTCTCAAAGTGATTTTGGGACAACCAGCCTAAAGTATTTAGATCTGAGCTTCAATGGTGTTATTACCATGAGTTCAAACTTCTTGGGCTTAGAACAACTAGAACATCTGGATTTCCAGCATTCCAATTTGAAACAAATGAGTGAGTTTTCAGTATTCCTATCACTCAGAAACCTCATTTACCTTGACATTTCTCATACTCACACCAGAGTTGCTTTCAATGGCATCTTCAATGGCTTGTCCAGTCTCGAAGTCTTGAAAATGGCTGGCAATTCTTTCCAGGAAAACTTCCTTCCAGATATCTTCACAGAGCTGAGAAACTTGACCTTCCTGGACCTCTC

Ensembl | Human Hinterlegungsnummer

ENSG00000136869

NCBI-Hinterlegungsnummer

NM_138554

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... TLR4(7099) , TLR4(7099)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Emmeline L Blanchard et al.
Molecular therapy. Nucleic acids, 14, 52-66 (2018-12-24)
The characterization of innate immune activation is crucial for vaccine and therapeutic development, including RNA-based vaccines, a promising approach. Current measurement methods quantify type I interferon and inflammatory cytokine production, but they do not allow for the isolation of individual pathways, do
Daniela Verzola et al.
Journal of cachexia, sarcopenia and muscle, 8(1), 131-144 (2016-11-30)
Inflammation in skeletal muscle is implicated in the pathogenesis of insulin resistance and cachexia but why uremia up-regulates pro-inflammatory cytokines is unknown. Toll-like receptors (TLRs) regulate locally the innate immune responses, but it is unknown whether in chronic kidney disease
Daohai Zhang et al.
Kidney & blood pressure research, 42(6), 1205-1215 (2017-12-12)
Hyperphosphatemia is one of the most notable features of chronic kidney disease (CKD). Numerous epidemiological and clinical studies have found that high serum phosphate concentrations are associated with calcification in the coronary arteries. However, the mechanisms underlying the vascular calcification
Zhenggang Luan et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 46(5), 1907-1918 (2018-05-03)
The high mobility group box 1 (HMGB1) has been regarded as an important inflammatory mediator. Previous studies showed the involvement of HMGB1 protein in the dysfunction of endothelial barrier function during acute lung injury. However, the molecular mechanism remains unclear.
Jing Chang et al.
PloS one, 12(9), e0184770-e0184770 (2017-09-13)
Interleukin 33 (IL-33), an inflammatory and mechanically responsive cytokine, is an important component of a TLR4-dependent innate immune process in mucosal epithelium. Although TLR4 also plays a role in sensing biomechanical stretch, a pathway of stretch-induced TLR4-dependent IL-33 biosynthesis has
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.